Parasite infection reflects host genetic diversity among non-native populations of pumpkinseed sunfish in Europe

Ondračková, Markéta; Bartáková, Veronika; Kvach, Yuriy; Bryjová, Anna; Trichkova, Teodora; Ribeiro, Filipe; Carassou, Laure; Martens, Andreas; Masson, G.; Zechmeister, Thomas; Jurajda, Pavel

doi:10.1007/s10750-020-04410-y

Cited by 14 publications

(59 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this study, the overall diversity of pumpkinseed parasite fauna was relatively low and did not differ significantly from that in other European populations (e.g., Moravec, 2001 and references therein;Hockley et al, 2011;Stoyanov et al, 2017;Ondračková et al, 2021).…”

Section: Discussioncontrasting

confidence: 48%

“…For two or three fish from each study locality, the partial mitochondrial cox1 gene was amplified using the primers Fish-F1(5'TCAACCAACCACAAAGACATTGGCAC3 0 ) and Fish-R1 (5'TAGACTTCTGGGTGGCCAAAGAATCA3 0 ) (Ward et al, 2005). The same primers were also used to amplify the partial mitochondrial cox1 gene of pumpkinseed from the following (for further details on the sampling localities, see Ondračková et al, 2021). PCR products were sequenced commercially at Eurofins Genomics Germany GmbH.…”

Section: Fish Genetic Analysismentioning

confidence: 99%

“…Individual genetic variation in the Oder pumpkinseed populations was visualized using the scores of the first two axes obtained from factorial correspondence analysis, as performed in GENETIX v. 4.05 (Belkhir et al, 1996(Belkhir et al, -2004. A Bayesian clustering algorithm, implemented in STRUCTURE v. 2.3.4 (Hubisz et al, 2009), was conducted to assess the population genetic structure of non-native European pumpkinseed populations, using 100 individuals from the five Oder pumpkinseed populations and a further 140 individuals from the seven European populations analysed for cox1 mtDNA (originally published by Ondračková et al, 2021, see above). The program was run with 10 independent simulations for each K from 1 to 12, with 1 million iterations for each simulation (burn-in = 100,000 iterations), using an admixture model and a correlated allele frequencies model (λ = 1).…”

Section: Fish Genetic Analysismentioning

confidence: 99%

See 2 more Smart Citations

Population genetic structure, parasite infection and somatic condition of pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in the Oder river basin

Ondračková

Mariia

Bartáková

et al. 2022

Journal of Fish Biology

Self Cite

View full text Add to dashboard Cite

In Poland, distribution of non‐native pumpkinseed Lepomis gibbosus (Centrarchidae) is strictly limited to the Oder river basin, where it was introduced in the early 20th century. Recently, several populations have been found in waterbodies adjacent to the Oder, particularly in its lower reaches. In this study, we compare the genetic relatedness of populations in the Oder basin with other European populations using nuclear (microsatellite) and mitochondrial (partial cytochrome c oxidase subunit I; cox1) markers. Microsatellite analysis indicated that four populations in the lower Oder form a separate cluster, while one in the middle Oder clustered with Danubian populations, from where probably having been introduced. Microsatellite data suggested that the lower Oder populations differ from other non‐native European populations, making it impossible to estimate the source of introduction. Nevertheless, analysis of cox1 indicated that Oder pumpkinseeds belong to the same haplotype as the vast majority of European populations. Parasitological examination confirmed the presence of two North American species, the monogenean Onchocleidus dispar and trematode Posthodiplostomum centrarchi, in the lower Oder, both previously unknown in the region. Fifteen other parasite species were acquired, including glochidia of invasive Sinanodonta woodiana. In the middle Oder, parasite infection was more limited. Fish from the Gryfino Canal, considered one of the most invasive populations in Europe, showed the highest parasite abundance and diversity, and the highest somatic condition and growth rate due to warm water released from the Dolna Odra power plant. Our results highlight significant differences in somatic condition and parasite infection in long‐established non‐native pumpkinseed populations in the same river system, reflecting mainly environmental conditions.

show abstract

Section: Discussioncontrasting

confidence: 48%

Section: Fish Genetic Analysismentioning

confidence: 99%

Section: Fish Genetic Analysismentioning

confidence: 99%

See 1 more Smart Citation

Population genetic structure, parasite infection and somatic condition of pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in the Oder river basin

Ondračková

Mariia

Bartáková

et al. 2022

Journal of Fish Biology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Several life history characteristics, including high reproductive plasticity, ovoviviparity and the ability to reproduce parthenogenetically as well as lack of castrating parasites, which are common in its native range, may all contribute to the success of another high-impact AIS, the apple snail Potamopyrgus antipodarum (Gray, 1843) (Verhaegen et al, 2021). Parasite loads and diversity can vary across different populations of the same invader depending on the size of the source population, with larger founding populations more likely to harbor greater parasite diversity, as demonstrated in genetically distinct and independently introduced populations of pumpkinseed sunfish, Lepomis gibbosus (Linnaeus, 1758) in Europe (Ondračková et al, 2021). This study also highlights the potential use of parasite diversity to discriminate genetically distinct populations of non-native fishes.…”

Section: What Distinguishes High-impact Ais?mentioning

confidence: 99%

Aquatic invasive species: introduction to the Special Issue and dynamics of public interest

et al. 2021

View full text Add to dashboard Cite

“…The pumpkinseed sunfish (Lepomis gibbosus) was introduced at the end of the 19th century in several countries in Europe. The species has spread from Germany to Central Europe through the Danube River [42]. This Mid-European linage includes populations with high and low genetic diversity (the heterozygosity ranges between 0.31-0.75 and mean allelic richness between 2 and 5).…”

Section: Discussionmentioning

confidence: 99%

Comparison of the Genetic Structure of Invasive Bigheaded Carp (Hypophthalmichthys spp.) Populations in Central-European Lacustrine and Riverine Habitats

Molnár

Lehoczky²,

Meleg³

et al. 2021

Animals

View full text Add to dashboard Cite

Bigheaded carps (bighead carp, Hypophthalmichthys molitrix, and silver carp, Hypophthalmichthys nobilis) and their hybrids play an important ecological and economic role in their original habitat, while their introduced stocks may pose serious ecological risks. To address questions about the persistence and invasiveness of these fish, we need to better understand their population structures. The genetic structures of bigheaded carp populations inhabiting Lake Balaton and the Tisza River were examined with ten microsatellite markers and a mitochondrial DNA marker (COI). The Lake Balaton stock showed higher genetic diversity compared with the Tisza River stock. Based on hierarchical clustering, the Tisza population was characterized only by only silver carps, while the Balaton stock included hybrid and silver carp individuals. All COI haplotypes originated from the Yangtze River. Based on the high genomic and mitochondrial diversity, along with the significant deviation from H–W equilibrium and the lack of evidence of bottleneck effect, it can be assumed that bigheaded carps do not reproduce in Lake Balaton. The present stock in Balaton may have originated from repeated introductions and escapes from the surrounding fishponds. The Tisza stock consists solely of silver carp individuals. This stock appears to have significant reproductive potential and may become invasive if environmental factors change due to climate change.

show abstract

Parasite infection reflects host genetic diversity among non-native populations of pumpkinseed sunfish in Europe

Cited by 14 publications

References 55 publications

Population genetic structure, parasite infection and somatic condition of pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in the Oder river basin

Population genetic structure, parasite infection and somatic condition of pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in the Oder river basin

Aquatic invasive species: introduction to the Special Issue and dynamics of public interest

Comparison of the Genetic Structure of Invasive Bigheaded Carp (Hypophthalmichthys spp.) Populations in Central-European Lacustrine and Riverine Habitats

Contact Info

Product

Resources

About