Pathology and immunity after SARS-CoV-2 infection in male ferrets is affected by age and inoculation route

Abstract

Improving COVID-19 intervention strategies partly relies on animal models to study SARS-CoV-2 disease and immunity. In our pursuit to establish a model for severe COVID-19, we inoculated young and adult male ferrets intranasally or intratracheally with SARS-CoV-2. Intranasal inoculation established an infection in all ferrets, with viral dissemination into the brain and gut. Upon intratracheal inoculation only adult ferrets became infected. However, neither inoculation route induced observable COVID-19 symptoms. Despite this, a persistent inflammation in the nose was prominent in especially young ferrets and follicular hyperplasia in the bronchi developed 21 days post infection. These effects -if sustained- might resemble long-COVID. Respiratory and systemic cellular responses and antibody responses were induced only in animals with an established infection. We conclude that intranasally-infected ferrets resemble asymptomatic COVID-19 and possibly aspects of long-COVID. Combined with the increasing portfolio to measure adaptive immunity, ferrets are a relevant model for SARS-CoV-2 vaccine research.

Influenza infection in ferrets with SARS-CoV-2 infection history

“…Yet, only a moderate inflammation in the nasal turbinates was observed, and no histopathology alterations were found in the lower respiratory tract. We assume, however, that the absence of pathology in the present study is due to the low level of productive infection when using the beta VOC, since effective SARS-CoV-2 viral replication frequently resulted in pathology manifestation in ferrets in other studies [19, 22, 23, 29, 30, 41].…”

“…In a previous study using SARS-CoV-2 with the D614G mutation, we observed inflammatory infiltration in the upper respiratory tract and hyperplasia of bronchus-associated lymphoid tissue in the lungs of infected male ferrets on 21 d.p.i. [23]. The late histopathology findings may reflect, in part, the extended signs and symptoms observed in human long-COVID.…”

“…Clinical signs comprise decreased behavioral activity, increased severity of breathing, nasal discharge and sneezing. The clinical endpoints were based on activity (0 = active; 1 = active when stimulated; 2 = inactive and 3 = lethargic) and breathing (0 = normal; 1 = fast breathing; 2 = heavy/stomach breathing); ferrets were euthanized if lethargic or presenting a combined score of 4 for activity and breathing [23]. Body temperature was measured by the implanted temperature transponder every 30 minutes from five days prior to each infection.…”

“…For H1N1 the primers and probe are designed for the H1N1pmd09 and was detected using the E-gene forward (TGGACTTACAATGCCGAACT) and reverse (CAGCGGTTTCCAATTTCCTT) and probe (GGACTATCACGATTCAAATGTGAAGAACT). RT-qPCR was performed for 10 minutes at 95°C, followed by 40 cycles of 95°C for 30 seconds and primer-specific annealing temperature of 60°C for 45 seconds, as previously described [23][24][25]. This was followed by 95°C for 15 seconds, 53°C for 60 seconds and 95°C for 15 seconds.…”

“…Ferrets are the best small animal model for influenza infection and disease and they are also susceptible for SARS-CoV-2 infection, albeit reproducing only mild or non-clinical COVID- 19 [14, 21, 22]. Nevertheless, follicular hyperplasia in the higher airways of the lung and inflammatory infiltration in the nasal cavity has been observed 21 days after experimental infection with SARS-CoV-2, when the viral infection was long cleared [23]. These observations could reflect, in part, the long-term disease (post-acute COVID-19) characterized by prolonged respiratory complaints and fatigue.…”