Pathophysiology of hypertension in response to placental ischemia during pregnancy: A central role for endothelin?

LaMarca, Babbette; Alexander, Barbara T.; Gilbert, Jeffery; Ryan, Michael J.; Sedeek, Mona; Murphy, Sydney; Granger, Joey P.

doi:10.1016/j.genm.2008.03.013

Cited by 48 publications

(48 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Briefly, cDNA was synthesized from 1 g of RNA with Bio-Rad Iscript cDNA reverse transcriptase, and real-time PCR was performed using the Bio-Rad SYBR Green Supermix and iCycler. The following primer sequences, provided by Life technologies, were used for preproendothelin (PPET), as previously described: forward 1, ctaggtctaagcgatccttg and reverse 1, tctttgtctgcttggc (21,24,25). Levels of mRNA were calculated using the mathematical formula for 2 Determination of placental and renal reactive oxygen species.…”

Section: Adoptive Transfer Of Np and Rupp T Reg Cellsmentioning

confidence: 99%

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

Cornelius

Amaral

Harmon

et al. 2015

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

The reduced uterine perfusion pressure (RUPP) rat model of preeclampsia exhibits much of the pathology characterizing this disease, such as hypertension, inflammation, suppressed regulatory T cells (T Regs), reactive oxygen species (ROS), and autoantibodies to the ANG II type I receptor (AT1-AA) during pregnancy. The objective of this study was to determine whether supplementation of normal pregnant (NP) TRegs into RUPP rats would attenuate the pathophysiology associated with preeclampsia during pregnancy. CD4 ϩ /CD25ϩ T cells were isolated from spleens of NP and RUPP rats, cultured, and injected into gestation day (GD) 12 normal pregnant rats that underwent the RUPP procedure on GD 14. On GD 1, mean arterial pressure (MAP) was recorded, and blood and tissues were collected for analysis. One-way ANOVA was used for statistical analysis. MAP increased from 99 Ϯ 2 mmHg in NP (n ϭ 12) to 127 Ϯ 2 mmHg in RUPP (n ϭ 21) but decreased to 118 Ϯ 2 mmHg in RUPPϩNP TRegs (n ϭ 17). Circulating IL-6 and IL-10 were not significantly changed, while circulating TNF-␣ and IL-17 were significantly decreased after supplementation of TRegs. Placental and renal ROS were 339 Ϯ 58.7 and 603 Ϯ 88.1 RLU·min Ϫ1 ·mgϪ1 in RUPP and significantly decreased to 178 Ϯ 27.8 and 171 Ϯ 55.6 RLU·min Ϫ1 ·mg Ϫ1 , respectively, in RUPPϩNP TRegs; AT1-AA was 17.81 Ϯ 1.1 beats per minute (bpm) in RUPP but was attenuated to 0.50 Ϯ 0.3 bpm with NP TRegs. This study demonstrates that NP TRegs can significantly improve inflammatory mediators, such as IL-17, TNF-␣, and AT 1-AA, which have been shown to increase blood pressure during pregnancy.hypertension; pregnancy; inflammation; oxidative stress; regulatory T cells PREECLAMPSIA IS A PREGNANCY-ASSOCIATED disorder that affects 5-8% of pregnancies and is a major cause of maternal, fetal, and neonatal morbidity and mortality (9,29,37). Hallmark characteristics of preeclampsia are new-onset hypertension after 20 wk gestation, proteinuria, chronic immune activation, fetal growth restriction, and maternal endothelial dysfunction. The pathophysiological mechanisms that lead to the development of preeclampsia are poorly understood. It is thought that poor invasion of trophoblasts leads to insufficient spiral artery remodeling, resulting in placental ischemia (4, 10, 31). The hypoxic environment that results from this placental ischemia is suggested to be an important factor in the development of oxidative stress and a shift in the balance of antiangiogenic and proangiogenic factors, which plays a role in endothelial dysfunction of the placenta and maternal vasculature (10). Previous studies from our laboratory in the reduced uterine perfusion pressure (RUPP) rat model of preeclampsia demonstrate that the total population of CD4-positive (CD4 ϩ ) T cells isolated from RUPP spleens and transferred to NP rats causes similar pathology to that seen in RUPP rats (46), demonstrating a role for this population in mediating pathophysiology in response to placental ischemia. Recent data from both clinical and animal model stud...

show abstract

Section: Adoptive Transfer Of Np and Rupp T Reg Cellsmentioning

confidence: 99%

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

Cornelius

Amaral

Harmon

et al. 2015

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

show abstract

“…cDNA was synthesized from 1 g of RNA with Bio-Rad Iscript cDNA reverse transcriptase and real-time PCR was performed using the Bio-Rad Sybre Green Supermix and iCycler. The following primer sequences provided by Life technologies were used for PPET as previously described: forward 1, ctaggtctaagcgatccttg, and reverse 1, tctttgtctgcttggc (8,10,15 Endothelial cell endothelin-1 production. The experimental protocol to determine whether adoptive transfer of CD4 ϩ T cells from RUPP rats would cause an increase in vascular (human umbilical vein endothelial cells, HUVEC) secretion of ET-1, therefore, the HUVEC bioassay was performed as previously shown (13,15,25).…”

Section: Methodsmentioning

confidence: 99%

“…Endothelin was determined using 100 l of collected HUVEC media and measured using the ET-1 Quantikine ELISA kit from R&D systems (8,10,15). According to the manufacturer reports the assay displayed a sensitivity of 0.023 to 0.102 pg/ml, inter-assay variability of 8.9%, and intra-assay variability of 3.4%.…”

Section: Methodsmentioning

confidence: 99%

“…Previous studies have demonstrated a twofold increase in ET-1 secretion from endothelial cells in response to serum from RUPP rats compared with serum from NP rats (8,15). To examine the role of adoptive transfer of CD4 ϩ T cells in mediating endothelial activation and dysfunction, we exposed HUVECs to serum collected from control NP and RUPP rats and serum from rats adoptively transferred CD4 ϩ T cells.…”

Section: Huvec Et-1 Secretion Is Increased In Response To Adoptive Trmentioning

confidence: 99%

“…This study demonstrates the importance of CD4 ϩ T cells in response to placental ischemia to cause elevations in blood pressure potentially by stimulating the AT1-AA from NP recipient rats. We have previously shown the importance of the AT1-AA to mediate blood pressure increases during pregnancy by stimulating production of ET-1 and activation of the ET A receptors (8). Furthermore, we have shown the importance of endogenous AT1-AA in RUPP rats to stimulate ET-1 activation as one mechanism of causing hypertension in response to placental ischemia (30).…”

mentioning

confidence: 94%

See 2 more Smart Citations

Hypertension in response to CD4⁺ T cells from reduced uterine perfusion pregnant rats is associated with activation of the endothelin-1 system

Wallace

Novotny

Heath

et al. 2012

American Journal of Physiology-Regulatory, Integrative and Comp

View full text Add to dashboard Cite

ϩ T cells from placental ischemia (reduction in uteroplacental perfusion, RUPP) rats causes hypertension and elevated inflammatory cytokines during pregnancy. In this study we tested the hypothesis that adoptive transfer of RUPP CD4 ϩ T cells was associated with endothelin-1 activation as a mechanism to increase blood pressure during pregnancy. CD4 ϩ T cells from RUPP or normal pregnant (NP) rats were adoptively transferred into NP rats on gestational day 13. Mean arterial pressure (MAP) was analyzed on gestational day 19, and tissues were collected for endothelin-1 analysis. MAP increased in placental ischemic RUPP rats versus NP rats (124.1 Ϯ 3 vs. 96.2 Ϯ 3 mmHg; P ϭ 0.0001) and increased in NP recipients of RUPP CD4 ϩ T cells (117.8 Ϯ 2 mmHg; P ϭ 0.001 compared with NP). Adoptive transfer of RUPP CD4 ϩ T cells increased placental preproendothelin-1 mRNA 2.1-fold compared with NP CD4 ϩ T cell rats and 1.7-fold compared with NP. Endothelin-1 secretion from endothelial cells exposed to NP rat serum was 52.2 Ϯ 1.9 pg·mg Ϫ1 ·ml Ϫ1 , 77.5 Ϯ 4.3 pg·mg Ϫ1 ·ml Ϫ1 with RUPP rat serum (P ϭ 0.0003); 47.2 Ϯ .16 pg·mg Ϫ1 ·ml Ϫ1 with NPϩNP CD4 ϩ T cell serum, and 62.2 Ϯ 2.1 pg·mg Ϫ1 ·ml Ϫ1 with NPϩRUPP CD4 ϩ T cell serum (P ϭ 0.002). To test the role of endothelin-1 in RUPP CD4ϩ T cell-induced hypertension, pregnant rats were treated with an endothelin A (ETA) receptor antagonist (ABT-627, 5 mg/kg) via drinking water. MAP was 92 Ϯ 2 mmHg in NPϩETA blockade and 108 Ϯ 3 mmHg in RUPPϩETA blockade; 95 Ϯ 5 mmHg in NPϩNP CD4ϩ T cellsϩETA blockade and 102 Ϯ 2 mmHg in NPϩRUPP CD4ϩ T cellsϩETA blockade. These data indicate the importance of endothelin-1 activation to cause hypertension via chronic exposure to activated CD4 ϩ T cells in response to placental ischemia. pregnancy; T helper cells; placental ischemia PREECLAMPSIA, a hypertensive disorder of pregnancy, clinically characterized by new onset maternal hypertension and proteinuria after 20 wk gestation, typically affects 2-7% of pregnancies in the United States and contributes to almost 20% of maternal deaths in the United States (18,22). Hypertension in pregnancy, which occurs in response to placental ischemia, is associated with endothelial dysfunction, elevated circulating and placental inflammatory cytokines, and, in some cases, intrauterine growth restriction (2, 4, 7, 12). One hallmark of endothelial dysfunction is activation of the endothelin-1 (ET-1) pathway. Elevation of the vasoconstrictor peptide ET-1 and activation of the endothelin A (ET A ) receptor mediates vasoconstriction and elevated blood pressure. This serves as one mechanism of hypertension in response to placental ischemia that is hypothesized to play a role in the pathophysiology of preeclampsia (5,(22)(23)(24). A reduction in uteroplacental perfusion (RUPP), thought to be an initiating event in preeclampsia, contributes to wide-spread dysfunction of the maternal vascular endothelium during pregnancy (5,23,24). Serum from women with preeclampsia and serum from animal models of placental ischemia induced...

show abstract

Hypertension: Physiology and Pathophysiology

Hall

Granger

Carmo

et al. 2012

Comprehensive Physiology

204

187

View full text Add to dashboard Cite

Despite major advances in understanding the pathophysiology of hypertension and availability of effective and safe antihypertensive drugs, suboptimal blood pressure (BP) control is still the most important risk factor for cardiovascular mortality and is globally responsible for more than 7 million deaths annually. Short-term and long-term BP regulation involve the integrated actions of multiple cardiovascular, renal, neural, endocrine, and local tissue control systems. Clinical and experimental observations strongly support a central role for the kidneys in the long-term regulation of BP, and abnormal renal-pressure natriuresis is present in all forms of chronic hypertension. Impaired renal-pressure natriuresis and chronic hypertension can be caused by intrarenal or extrarenal factors that reduce glomerular filtration rate or increase renal tubular reabsorption of salt and water; these factors include excessive activation of the renin-angiotensin-aldosterone and sympathetic nervous systems, increased formation of reactive oxygen species, endothelin, and inflammatory cytokines, or decreased synthesis of nitric oxide and various natriuretic factors. In human primary (essential) hypertension, the precise causes of impaired renal function are not completely understood, although excessive weight gain and dietary factors appear to play a major role since hypertension is rare in nonobese hunter-gathers living in nonindustrialized societies. Recent advances in genetics offer opportunities to discover gene-environment interactions that may also contribute to hypertension, although success thus far has been limited mainly to identification of rare monogenic forms of hypertension.

show abstract

Pathophysiology of hypertension in response to placental ischemia during pregnancy: A central role for endothelin?

Abstract: Background-Preeclampsia is new onset hypertension during pregnancy with proteinuria. The initiating event in preeclampsia has been postulated to involve reduce placental perfusion which leads to widespread dysfunction of the maternal vascular endothelium.

Cited by 48 publications

References 43 publications

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

Hypertension in response to CD4⁺ T cells from reduced uterine perfusion pregnant rats is associated with activation of the endothelin-1 system

Hypertension: Physiology and Pathophysiology

Contact Info

Product

Resources

About

Pathophysiology of hypertension in response to placental ischemia during pregnancy: A central role for endothelin?

Abstract: Background-Preeclampsia is new onset hypertension during pregnancy with proteinuria. The initiating event in preeclampsia has been postulated to involve reduce placental perfusion which leads to widespread dysfunction of the maternal vascular endothelium.

Cited by 48 publications

References 43 publications

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

An increased population of regulatory T cells improves the pathophysiology of placental ischemia in a rat model of preeclampsia

Hypertension in response to CD4+ T cells from reduced uterine perfusion pregnant rats is associated with activation of the endothelin-1 system

Hypertension: Physiology and Pathophysiology

Contact Info

Product

Resources

About

Hypertension in response to CD4⁺ T cells from reduced uterine perfusion pregnant rats is associated with activation of the endothelin-1 system