PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1
            <sup>T</sup>

Cheng, Minggen; Chen, Kai; Guo, Shanshan; Huang, Xing; He, Jun; Li, Shunpeng; Jiang, Jiandong

doi:10.1128/aem.02122-15

Cited by 15 publications

(3 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…When required cell extracts were dialyzed using Thermo Scienti c Slide-A-Lyzer MINI Dialysis Devices, 2K MWCO following the manufacturer's instructions. The presence of esterase and 3PBA dioxygenase enzyme was veri ed using the method and primers ESTf-5′ATTATACCCGCCCAGTCGCT, ESTr-ATGAATATGCTCCGCCCCGAC3′ and pbaf-5' AACGGTATAGTCAAAGCCAGCATAT, pbar-CGCATCCCAGTTGCCAAAAATCA previously de ned (Gangola et al, 2018;Cheng et al, 2015). Those primers were used to assess the transcription of both of the enzymes in the induced, non-induced, and inhibited cells.…”

Section: Enzyme Assaysmentioning

confidence: 99%

“…Those primers were used to assess the transcription of both of the enzymes in the induced, non-induced, and inhibited cells. cDNA synthesis from RNA extraction and qPCR was conducted following the method previously described (Cheng et al, 2015).…”

Section: Enzyme Assaysmentioning

confidence: 99%

“…Gangola et al, 2018) have been puri ed able to perform the rst step in the CYP degradation. The transformation of 3PBA to phenol was studied and studies indicated that type I Rieske nonheme iron aromatic-ring-hydroxylating oxygenase (RHO) is responsible(Cheng et al, 2015). SDS page for overexpressing of this gene cluster revealed bands of 97, 51, 31, 28, 20 and 19 kDa which the one at 28 kDa was measured to be active for 3PBA deoxidation(Cheng et al, 2015).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Establishing the Catabolic Pathway of Commercial Cypermethrin and Discovering the Inhibitor of 3- Phenoxy Benzoic Acid Biodegradation by Fig Farm Isolated Enterobacter hormaechei strain ZK101 and Stenotrophomonas maltophilia strain ZK102

Kurt

KOKANGUL

2023

Preprint

View full text Add to dashboard Cite

Cypermethrin (CYP) is a commonly used type Ⅱ pyrethroid against pest control in agriculture and household. Its excessive use has the potential to cause serious secondary environmental pollution. Biodegradation in the environment minimizes contamination however the metabolites, could also harm the environment more than the main product of interest. Therefore, optimum degradation rates and possible effects of bioremediation should be understood to evaluate its applicability. In this study, isolates obtained from soil exposed to CYP from fig farms in Adana were investigated to identify their CYP biodegradation pathway, and the key enzymes responsible for biodegradation, to optimize the biodegradation, and to indicate the inhibitors that affect their ability to mineralize CYP. Enterobacter hormaechei strain ZK101 and Stenotrophomonas maltophilia strain ZK102 both degraded CYP with first-order kinetics through esterification followed by 3-phenoxy benzoic acid (3PBA) deoxygenation. Strains accumulated 3PBA when they have been reinoculated to the soil due to the copper present (40 ppm) in the soil causing the inhibition of 3PBA dioxygenase. The work here is the first study that tested the potential of CYP degradation when isolates were re-inoculated in the soil and showed that CYP degraders in the field will cause an accumulation of a more toxic contaminant than CYP. The results of this study help to understand the effects of bacterial applications for CYP contamination and reveal the negative effects of microbial responses in the field.

show abstract

Section: Enzyme Assaysmentioning

confidence: 99%

Section: Enzyme Assaysmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation