PcaO Positively Regulates pcaHG of the β-Ketoadipate Pathway in Corynebacterium glutamicum

Abstract

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the ␤-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167⌬pcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoterLacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ( ؊78 AACCCCTGACCTTCGGGGTT ؊59 ) that was located upstream of the ؊35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.Protocatechuic acid (PCA) is an important intermediate during microbial degradation of various aromatic compounds, including natural products such as lignin monomers and chemically synthesized chemicals such as 4-chlorobenzoate. In many bacteria (5,8,12,13,16,20,23,25,30,34), PCA is degraded via the ␤-ketoadipate pathway (Fig. 1A), and the ring cleavage dioxygenase (PCA 3,4-dioxygenase) is encoded by two consecutive genes, pcaHG (3). The pcaHG genes, together with other pca genes involved in PCA degradation, have been extensively investigated in Gram-negative bacteria, such as Pseudomonas putida (12,23) and Acinetobacter baylyi (10, 28), and recently have been investigated in Gram-positive bacteria, such as Rhodococcus and Streptomyces species (8, 16) (Fig. 1B).Regulation of the PCA branch of the ␤-ketoadipate pathway has been investigated using several Gram-negative bacteria (41), and information is accumulating. In P. putida, the IclRtype PcaR protein regulates pcaIJBDCF (11, 30); however, how pcaHG is regulated is still unknown. In A. baylyi, the IclR-type PcaU protein regulates the pcaIJFBDKCHG operon, and PCA is the effector (10, 28, 40). In Sinorhizobium meliloti, PcaR regulates pcaIJF, while the LysR-type protein PcaQ regulates pcaDCHGB (20, 21). In Agrobacterium tumefaciens, PcaQ regulates pcaDCHGB and pcaJIF with ␤-carboxy-cis,cismuconate and ␤-ketoadipate as effectors (25,26). Putative regulators have been identified in Gram-positive bacteria, such as Corynebacterium glutamicum and Rhodococcus opacus (2,8,34,35); however, the regulation of the PCA branch of the ␤-ketoadipate pathway has not been well docu...

Degradation and assimilation of aromatic compounds by Corynebacterium glutamicum: another potential for applications for this bacterium?

“…In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration. These findings suggest that in the presence of protocatechuate, the transcription of pcaHG is probably controlled by the ratio of ATP to ADP in cells (Zhao et al 2010). The PcaR-PcaO hierarchical regulatory system in C. glutamicum provides a flexible control that necessary for the degradation of various aromatic compounds that are channeled to the protocatechuate pathway.…”

“…2a). The pcaR gene encodes a transcriptional regulator of the IclR family and pcaO codes for a transcriptional activator of the large ATP-binding LuxR (LAL)-type regulator family (Brune et al 2005;Zhao et al 2010). PcaR exerts its regulatory role by interacting with 15-bp operator sequences that are located in the pcaI-pcaR intergenic region and upstream of pcaH and pobA.…”

“…A global analysis of C. glutamicum genome revealed that the transcriptional regulation of aromatic compound degradation in C. glutamicum is mainly controlled by single regulatory protein sensing the presence of aromatic compounds, thus representing single input motifs within the transcriptional regulatory network (Brinkrolf et al 2006). Several genes encoding transcriptional regulators have been identified, including the PcaO and PcaR that regulate the protocatechuate pathway (Brune et al 2005;Zhao et al 2010), the NagR that regulates the gentisate pathway (Shen et al 2005b), the RolR that regulates the hydroxyquinol pathway (Huang et al 2006;.…”

“…PcaR exerts its regulatory role by interacting with 15-bp operator sequences that are located in the pcaI-pcaR intergenic region and upstream of pcaH and pobA. PcaO is the first LAL-type regulator involved in aromatic compounds catabolism (Zhao et al 2010), although the involvement of LAL-type regulators in regulation of different metabolic pathways has been intensively characterized (Panagiotidis et al 1998;van Beilen et al 2001;Evangelista-Martínez et al 2006). In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.…”

Phenylacetic Acid Catabolism and Its Transcriptional Regulation in Corynebacterium glutamicum

“…glutamicum is a well-studied, high-GC-content, Gram-positive soil bacterium of industrial importance. The ability of C. glutamicum to metabolize a variety of aromatic compounds has been studied for its type strain, ATCC 13032 (5,15,(41)(42)(43)49). However, no degradation of PAA by C. glutamicum was reported.…”