Pdx1 Expression in Irs2-deficient Mouse β-Cells Is Regulated in a Strain-dependent Manner

Suzuki, Ryo; Tobe, Kazuyuki; Terauchi, Yasuo; Komeda, Kajuro; Kubota, Naoto; Eto, Kazuhiro; Yamauchi, Toshimasa; Azuma, Kousuke; Kaneto, Hideaki; Taguchi, Takashi; Koga, Tetsufumi; German, Michael S.; Watada, Hirotaka; Kawamori, Ryuzo; Wright, Christopher V.E.; Kajimoto, Yoshitaka; Kimura, Satoshi; Nagai, Ryozo; Kadowaki, Takashi

doi:10.1074/jbc.m307004200

Cited by 32 publications

(30 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, we found normal expression of Pdx1 in islets and our findings do not support this conclusion. Indeed others have also reported that Pdx1 expression is normal in Irs2-null beta cells and that differences in expression may be mouse strain dependent [31]. In contrast, we found reduced Slc2a2 expression with concomitant reduction in protein production in PIrs2KO islets and this may further impair beta cell function.…”

Section: Discussioncontrasting

confidence: 55%

Pancreatic deletion of insulin receptor substrate 2 reduces beta and alpha cell mass and impairs glucose homeostasis in mice

et al. 2007

View full text Add to dashboard Cite

Aims/hypothesis Insulin signalling pathways regulate pancreatic beta cell function. Conditional gene targeting using the Cre/loxP system has demonstrated that mice lacking insulin receptor substrate 2 (IRS2) in the beta cell have reduced beta cell mass. However, these studies have been complicated by hypothalamic deletion when the RIPCre (B6.Cg-tg(Ins2-cre) 25Mgn/J) transgenic mouse (expressing Cre recombinase under the control of the rat insulin II promoter) is used to delete floxed alleles in insulin-expressing cells. These features have led to marked insulin resistance making the beta cellautonomous role of IRS2 difficult to determine. To establish the effect of deleting Irs2 only in the pancreas, we generated PIrs2KO mice in which Cre recombinase expression was driven by the promoter of the pancreatic and duodenal homeobox factor 1 (Pdx1, also known as Ipf1) gene. Materials and methodsIn vivo glucose homeostasis was examined in PIrs2KO mice using glucose tolerance and glucose-stimulated insulin secretion tests. Endocrine cell mass was determined by morphometric analysis. Islet function was examined in static cultures and by performing calcium imaging in Fluo3am-loaded beta cells. Islet gene expression was determined by RT-PCR. Results The PIrs2KO mice displayed glucose intolerance and impaired glucose-stimulated insulin secretion in vivo. Pancreatic insulin and glucagon content and beta and alpha cell mass were reduced. Glucose-stimulated insulin secretion and calcium mobilisation were attenuated in PIrs2KO islets. Expression of the Glut2 gene (also known as Slc2a2) was also reduced in PIrs2KO mice. Conclusions/interpretation These studies suggest that IRS2-dependent signalling in pancreatic islets is required not only for the maintenance of normal beta and alpha cell mass but is also involved in the regulation of insulin secretion.

show abstract

Section: Discussioncontrasting

confidence: 55%

Pancreatic deletion of insulin receptor substrate 2 reduces beta and alpha cell mass and impairs glucose homeostasis in mice

et al. 2007

View full text Add to dashboard Cite

show abstract

“…4b). In regard to this point, Suzuki et al reported finding that Pdx1 expression in Irs2 −/− mice is regulated in a straindependent manner [29]. Pdx1 expression was not downregulated in our Irs2 −/− murine beta cells that had a C57BL/6J background [29].…”

Section: P22 Phox Expression (Au)mentioning

confidence: 95%

“…Since Kushner et al reported that transgenic overexpression of Pdx1 restored beta cell mass in Irs2 −/− mice [28], Pdx1 may play a role in regulating beta cell mass. Nevertheless, because a haploinsufficiency of Pdx1 led to impaired beta cell function, but not to decreased beta cell mass [30], and because beta cell mass was smaller in our Irs2 −/− mice than in wild-type mice despite the Pdx1 expression level being maintained [29], two different pathways are involved in the stimulation of beta cell function and proliferation by a GKA.…”

Section: P22 Phox Expression (Au)mentioning

confidence: 99%

Control of beta cell function and proliferation in mice stimulated by small-molecule glucokinase activator under various conditions

et al. 2012

View full text Add to dashboard Cite

Aims/hypothesis We investigated changes in the expression of genes involved in beta cell function and proliferation in mouse islets stimulated with glucokinase activator (GKA) in order to elucidate the mechanisms by which GKA stimulates beta cell function and proliferation. Methods Islets isolated from mice were used to investigate changes in the expression of genes related to beta cell function and proliferation stimulated by GKA. In addition, Irs2 knockout (Irs2 −/− ) mice on a high-fat diet or a high-fat diet containing GKA were used to investigate the effects of GKA on beta cell proliferation in vivo. Results In wild-type mice, Irs2 and Pdx1 expression was increased by GKA. In Irs2 −/− mice, GKA administration increased the glucose-stimulated secretion of insulin and Pdx1 expression, but not beta cell proliferation. It was particularly noteworthy that oxidative stress inhibited the upregulation of the Irs2 and Pdx1 genes induced by GKA. Moreover, whereas neither GKA alone nor exendin-4 alone upregulated the expression of Irs2 and Pdx1 in the islets of db/db mice, prior administration of exendin-4 to the mice caused GKA to increase the expression of these genes.Conclusions/interpretation GKA-stimulated IRS2 production affected beta cell proliferation but not beta cell function. Oxidative stress diminished the effects of GKA on the changes in expression of genes involved in beta cell function and proliferation. A combination of GKA and an incretin-related agent might therefore be effective in therapy.

show abstract

“…The primers and probes were: DGAT1 forward, TCCGCCTCTGGGCATTC; DGAT1 reverse, GAATCGGCCCACAATCCA; DGAT1 probe, CCATGATGGCT-CAGGTCCCACTGG; DGAT2 forward, GCTGAGTCCCTGAGCTCCAT; DGAT2 reverse, CACAAAGCCTTTGCGGTTCT; DGAT2 probe, CCTG-GCAAGAACGCAGTCACCCTG. The sequences of the cyclophilin primers and probe are described elsewhere (22).…”

Section: Irs2mentioning

confidence: 99%

Expression of DGAT2 in White Adipose Tissue Is Regulated by Central Leptin Action

Suzuki

Tobe

Aoyama

et al. 2005

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Acyl-CoA:diacylglycerol acyltransferase (DGAT) enzymes catalyze the final step in mammalian triglyceride synthesis, and their functions are considered to be involved in the mechanisms of obesity, insulin resistance, and leptin resistance. Insulin receptor substrate-2 (IRS-2)-deficient mice exhibit obesity-associated with hypertrophic adipocytes and leptin resistance. Screening for transcripts of genes involved in fatty acid and triglyceride synthesis to investigate the mechanism of the hypertrophic change in the adipocytes showed that expression of DGAT2 mRNA was up-regulated in the white adipose tissue (WAT) of Irs2 ؊/؊ mice, whereas that of DGAT1 was down-regulated. This reciprocal expression of DGAT1 and DGAT2 was also observed in WAT of leptin-deficient ob/ob mice. A high fat diet also resulted in increased DGAT2 and reduced DGAT1 in the WAT of C57BL/6 mice. Induction of adipocyte hypertrophy in vitro up-regulated both DGAT1 and DGAT2 expression in 3T3-L1 cells, suggesting that adipocyte non-autonomous mechanism in vivo is required for the reciprocal changes in expression of DGAT1 and DGAT2. In fact, intracerebroventricular infusion of leptin reduced DGAT2 expression in WAT of Irs2 ؊/؊ mice and ob/ob mice, independently of DGAT1 expression. We propose the hypothesis that leptin regulates adipocyte size by altering expression patterns of DGAT via central nervous system to determine the levels of triglyceride synthesis.We have hypothesized that the size of adipocytes is inversely correlated with insulin sensitivity; namely, that larger adipocytes are associated with insulin resistance and smaller adipocytes are associated with insulin sensitivity (1). Acyl-CoA:diacylglycerol acyltransferase (DGAT) 1 is a key enzyme that catalyzes the final step in mammalian triglyceride synthesis (2), and two DGAT enzymes have been identified (3-5). Although the genes encoding DGAT1 and DGAT2 belong to different gene families, both genes are ubiquitously expressed and the enzymes they encode have similar substrate specificity (5). Dgat1 Ϫ/Ϫ mice have been reported to exhibit normal growth on a chow diet, and to be resistant to diet-induced obesity (6). Interestingly, Dgat1Ϫ/Ϫ mice exhibit increased insulin sensitivity and a leptin-sensitive phenotype associated with decreased tissue triglyceride content, suggesting that DGAT1 is somehow involved in insulin and leptin action throughout the body (7, 8). Recently, Dgat2Ϫ/Ϫ mice have been reported to exhibit marked reduction of triglyceride and fatty acids in the body, suggesting a critical role of DGAT2 in lipogenesis; however, the physiological roles of DGAT2 in adult mice are still unknown because Dgat2 Ϫ/Ϫ mice die soon after birth (9). The insulin receptor substrate (IRS) proteins play a key role in signal transduction from the insulin receptor (10, 11) and are major intracellular phosphorylation targets of activated insulin receptor tyrosine kinase. Irs2 Ϫ/Ϫ mice develop diabetes because of inadequate ␤-cell proliferation combined with insulin resistance (12-14). Another n...

show abstract

Pdx1 Expression in Irs2-deficient Mouse β-Cells Is Regulated in a Strain-dependent Manner

Cited by 32 publications

References 54 publications

Pancreatic deletion of insulin receptor substrate 2 reduces beta and alpha cell mass and impairs glucose homeostasis in mice

Pancreatic deletion of insulin receptor substrate 2 reduces beta and alpha cell mass and impairs glucose homeostasis in mice

Control of beta cell function and proliferation in mice stimulated by small-molecule glucokinase activator under various conditions

Expression of DGAT2 in White Adipose Tissue Is Regulated by Central Leptin Action

Contact Info

Product

Resources

About