Phenotypic integration emerges from aposematism and scale in poison frogs

Abstract

Complex phenotypes can be modeled as networks of component traits connected by genetic, developmental, or functional interactions. Aposematism, which has evolved multiple times in poison frogs (Dendrobatidae), links a warning signal to a chemical defense against predators. Other traits are involved in this complex phenotype. Most aposematic poison frogs are ant specialists, from which they sequester defensive alkaloids. We found that aposematic species have greater aerobic capacity, also related to diet specialization. To characterize the aposematic trait network more fully, we analyzed phylogenetic correlations among its hypothesized components: conspicuousness, chemical defense, diet specialization, body mass, active and resting metabolic rates, and aerobic scope. Conspicuous coloration was correlated with all components except resting metabolism. Structural equation modeling on the basis of trait correlations recovered "aposematism" as one of two latent variables in an integrated phenotypic network, the other being scaling with body mass and physiology ("scale"). Chemical defense and diet specialization were uniquely tied to aposematism whereas conspicuousness was related to scale. The phylogenetic distribution of the aposematic syndrome suggests two scenarios for its evolution: (i) chemical defense and conspicuousness preceded greater aerobic capacity, which supports the increased resource-gathering abilities required of ant-mite diet specialization; and (ii) assuming that prey are patchy, diet specialization and greater aerobic capacity evolved in tandem, and both traits subsequently facilitated the evolution of aposematism.allometry | biodiversity | multivariate | comparative methods S pecies display an array of developmentally complex and recurrent phenotypes produced by common ancestry, natural selection, and genetic drift (1, 2). Phenotypic integration is evidenced by developmental, heritable, and functional relationships among different sets of traits that coevolve and give rise to complex phenotypes (1). One such phenotype is aposematism, defined as the co-occurrence of warning signals and defense mechanisms (3). However, other traits (e.g., diet specialization and gregarious behavior) may also contribute to the aposematic phenotype (4). Here, we model the aposematic syndrome in poison frogs as a phenotypic network integrating several traits: conspicuousness, alkaloid sequestration, diet specialization, body mass, and metabolic rates.A. R. Wallace, who introduced the concept of aposematism, struggled to understand its evolution (5, 6). In aposematism, predators associate conspicuous prey with an unprofitable meal and refrain from attack (7). Thus, defended, the prey may expand its own foraging capabilities (8). The evolution of aposematism is complex for at least four reasons. First, some aposematic organisms synthesize or sequester defensive compounds (9). Second, conspicuousness (high contrast relative to background) signals to the predator that an attack is costly (10). Third, conspicuousness and d...

Maternally derived chemical defences are an effective deterrent against some predators of poison frog tadpoles ( Oophaga pumilio )

“…Snakes are well-known predators of many species of non-arboreal tadpoles in aquatic habitats [18]. Colubrid snakes and spiders also predate adult poison frogs [19]. In this study, snakes did not demonstrate obvious harm from eating alkaloid-containing tadpoles.…”

Radiation of the polymorphic Little Devil poison frog (Oophaga sylvatica) in Ecuador

“…Three mitochondrial (cytochrome oxidase subunit 1 [CO1 or cox1 ], 16S ribosomal DNA [16S], and 12S ribosomal DNA [12S] flanked with tRNA Val ) and three nuclear (recombination‐activating gene 1 [RAG‐1], tyrosinase [TYR], and sodium‐calcium exchanger 1 [NCX]) gene regions were PCR‐amplified using the following sets of primers for each gene: CO1 (CO1a‐H: 5′‐AGTATAAGCGTCTGGGTAGTC and CO1f‐L: 5′‐CCTGCAGGAGGAGGAGAYCC) (Palumbi et al., 2002), 16S (16sar‐L: 5′‐CGCCTGTTTATCAAAAAC and 16sbr‐H: 5′‐CCGGTCTGAACTCAGATCACGT) (Palumbi et al., 2002), 12S‐tRNA Val (MVZ59‐L: 5′‐ATAGCACTGAAAAYGCTDAGATG and tRNAval‐H: 5′‐GGTGTAAGCGARAGGCTTTKGTTAAG) (Santos & Cannatella, 2011), RAG‐1 (Rag1_Oop‐F1: 5′‐CCATGAAATCCAGCGAGCTC and Rag1_Oop‐R1: 5′‐CACGTTCAATGATCTCTGGGAC) (Hauswaldt et al., 2011), TYR (TYR_Oosyl_F: 5′‐AACTCATCATTGGGTTCACAATT and TYR_Oosyl_R: 5′‐GAAGTTCTCATCACCCGTAAGC), and NCX (NCX_Oosyl_F: 5′‐ACTATCAAGAAACCAAATGGTGAAA and NCX_Oosyl_R: 5′‐TGTGGCTGTTGTAGGTGACC). NCX and TYR primers were designed from publicly available O. sylvatica sequences (GenBank accession numbers HQ290747 and HQ290927).…”

Evidence of maternal provisioning of alkaloid‐based chemical defenses in the strawberry poison frog Oophaga pumilio

“…Brightly colored members of the family Dendrobatidae obtain alkaloid-based chemical defenses from a diet of alkaloid-containing mites, ants, millipedes, and beetles (reviewed in Saporito et al 2012). As a result of these defenses, some dendrobatids are unpalatable (and in some cases toxic) to many invertebrate and vertebrate predators (see the supplement of Santos and Cannatella 2011). However, studies of chemical defense in dendrobatids have focused almost entirely on adults (Daly et al 1987.…”

“…Eggs, but not tadpoles, of boreal toads (Anaxyrus [¼Bufo] boreas) are protected with bufadienolides (Benard and Fordyce 2003), and oocytes from redbelly toads (Melanophryniscus simplex) contain a variety of alkaloids (Grant et al 2012). Many parental amphibians chemically arm their eggs, but the effectiveness of these predator defenses generally decreases with offspring development (Hayes et al 2009, Santos andCannatella 2011). Dendrobatid frogs are well-studied vertebrates that sequester chemical defenses from dietary sources.…”