Phosphatidylinositol 3,5-bisphosphate regulates the transition betweentrans-SNARE complex formation and vacuole membrane fusion

Abstract

Phosphoinositides (PIs) regulate a myriad of cellular functions including membrane fusion, as exemplified by the yeast vacuole, which uses various PIs at different stages of fusion. In light of this, the effect of phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2) on vacuole fusion remains unknown. PI(3,5)P2 is made by the PI3P 5-kinase Fab1 and has been characterized as a regulator of vacuole fission during hyperosmotic shock, where it interacts with the TRP Ca2+ channel Yvc1. Here we demonstrate that exogenously added dioctanoyl (C8) PI(3,5)P2 abolishes homotypic vacuole fusion. This effect was not linked to Yvc1, as fusion was equally affected using yvc1Δ vacuoles. Thus, the effects of C8-PI(3,5)P2 on fusion and fission operate through distinct mechanisms. Further testing showed that C8-PI(3,5)P2 inhibited vacuole fusion after trans-SNARE pairing. Although SNARE complex formation was unaffected, we found that C8-PI(3,5)P2 blocked outer leaflet lipid mixing. Overproduction of endogenous PI(3,5)P2 by the fab1T2250A hyperactive kinase mutant also inhibited the lipid mixing stage, bolstering the model in which PI(3,5)P2 inhibits fusion when present at elevated levels. Taken together, this work identifies a novel function for PI(3,5)P2 as a regulator of vacuolar fusion. Moreover, it suggests that this lipid acts as a molecular switch between fission and fusion.

Copper blocks V‐ATPase activity and SNARE complex formation to inhibit yeast vacuole fusion

“…To further resolve the stage of the fusion pathway that was inhibited by Cu 2+ we performed a temporal gain of resistance assay . Individual fusion reactions were treated with inhibitors at different time points throughout the incubation period.…”

“…BJ3505, DKY6281, RFY74 (BJ3505 yvc1 Δ) and RFY75 (DKY6281 yvc1 Δ) were previously described were used for fusion assays . FRE6 was deleted by homologous recombination using PCR products amplified from pAG32 with primers 5′‐FRE6‐KO (5′‐ATCTTCTAAAGTGAAGCATGAC GACCATAGCTCGTTGAATCTGTTTAGCTTGCC TTGTCC‐3′) and 3′‐FRE6‐KO (5′‐TATAGGTG GGCGTAGGATCAGAAGGAGCCGGAGAGAAGA TGACACTGGATGGCGGCGTTA‐3′).…”

“…To further resolve the stage of the fusion pathway that was inhibited by Cu 2+ we performed a temporal gain of resistance assay. [28][29][30] Individual fusion reactions were treated with inhibitors at different time points throughout the incubation period. Vacuole fusion gains resistance to an inhibitor once the target of the reagent has had completed its function.…”

“…BJ3505, DKY6281, RFY74 (BJ3505 yvc1Δ) and RFY75 (DKY6281 yvc1Δ) were previously described 29,59,60 were used for fusion assays.…”

Copper Blocks V-ATPase Activity and SNARE Complex Formation to Inhibit Yeast Vacuole Fusion

“…To further resolve the stage of the fusion pathway that was inhibited by Cu 2+ we performed a temporal gain of resistance assay (20)(21)(22). Individual fusion reactions were treated with inhibitors at different time-points throughout the incubation period.…”