Phospholipase D1 Production of Phosphatidic Acid at the Plasma Membrane Promotes Exocytosis of Large Dense-core Granules at a Late Stage

Abstract

Substantial efforts have recently been made to demonstrate the importance of lipids and lipid-modifying enzymes in various membrane trafficking processes, including calcium-regulated exocytosis of hormones and neurotransmitters. Among bioactive lipids, phosphatidic acid (PA) is an attractive candidate to promote membrane fusion through its ability to change membrane topology. To date, however, the biosynthetic pathway, the dynamic location, and actual function of PA in secretory cells remain unknown. Using a short interference RNA strategy on chromaffin and PC12 cells, we demonstrate here that phospholipase D1 is activated in secretagogue-stimulated cells and that it produces PA at the plasma membrane at the secretory granule docking sites. We show that phospholipase D1 activation and PA production represent key events in the exocytotic progression. Membrane capacitance measurements indicate that reduction of endogenous PA impairs the formation of fusion-competent granules. Finally, we show that the PLD1 short interference RNAmediated inhibition of exocytosis can be rescued by exogenous provision of a lipid that favors the transition of opposed bi-layer membranes to hemifused membranes having the outer leaflets fused. Our findings demonstrate that PA synthesis is required during exocytosis to facilitate a late event in the granule fusion pathway. We propose that the underlying mechanism is related to the ability of PA to alter membrane curvature and promote hemi-fusion. Phosphatidic acid (PA)2 is a pleiotropic bioactive lipid that has been proposed to activate selected enzymes (1), recruit proteins to membrane surfaces (2), and serve as a substrate for the formation of other signaling lipids (3). Most intriguingly, PA has also been shown to promote negative curvature in bi-layer membranes due to its small polar head-group in combination with two fatty-acyl side chains (4). The bulk of cellular PA is synthesized via two different acylation pathways, the glycerol 3-phosphate pathway and the dihydroxy acetone phosphate pathway, which are named according to their respective precursors. However, PA is also produced via hydrolysis of phosphatidylcholine by phospholipase D (PLD) (5) on a much faster time scale, and this latter source is thought to underlie the dynamic regulation of PA that allows it to function as a signaling lipid in agonist-stimulated cell biological responses such as secretion and changes in cellular morphology.In mammals, the classic PLD family is composed of a pair of membrane-associated proteins, PLD1 and PLD2. Both PLD isoforms require phosphatidylinositol 4,5-bisphosphate for their enzymatic activity. However, whereas PLD2 exhibits relatively high basal activity in isolation, full activation of PLD1 requires its stimulation by small GTPases of the ADP-ribosylation factor (ARF), Rho and Ral families, and protein kinase C (3, 6). PLD enzymes have been proposed to be involved in a number of cellular processes, including cell growth and survival, cell differentiation, and vesicular trafficking (3)....

The Coffin–Lowry syndrome-associated protein RSK2 is implicated in calcium-regulated exocytosis through the regulation of PLD1

“…Antibodies anti-RSK2 E1 and anti-RSK1 or RSK3 (Santa Cruz Biotechnology), anti-p44/42 MAPK (New England BioLabs), anti-phospho-p44/42 MAPK, anti-phospho-PLD1 (Thr-147) (Cell Signaling), anti-HA (Covance Research Products), anti-actin (Sigma-Aldrich), and mouse anti-GFP (Roche Applied Science) were used. Anti-phospho-RSK, anti-human GH, and secondary antibodies coupled to Alexa conjugates have been described (13,36). The RSK inhibitor BI-D1870 was obtained from the Medical Research Council Protein Phosphorylation Unit, University of Dundee, Dundee, Scotland.…”

“…T147 mutants were obtained by sitedirected mutagenesis as described (37). GFP-PLD1, RSK2, RSK2 S227A, and T577A tagged with HA in pTL1 vectors have been described (13,19).…”

“…Rat RSK2 cDNA fragments encoding the 21-nt siRNA sequence CTGAAGAAGGCAGTATCAAAG (identical in rat and bovine) derived from the target transcript or the mutated cDNA fragment CTCTAGAAGGCAG-TATCAAAG, separated from their reverse 19-nt complement by a short spacer, were annealed and cloned in the BglII and HindIII sites in front of the H1 promoter of either the pEGFP-N2-RNAi plasmid or a modified pXGH5 plasmid encoding GH (pGHsuper) as described (13). PLD1 siRNA and PLD1 rescue plamids have been described (12).…”

“…In neuroendocrine cells, the PLD1 isoform is activated in response to secretagogues to produce PA at the granule docking sites on the plasma membrane as step essential for the late stages of exocytosis (13). Interestingly, PLD1 is a multimodule protein that displays very low basal activity and requires interactions with small GTPases of the ARF, Ral, and Rho families and PKC to be fully activated (14,15).…”

“…PLD1 has been identified as an essential lipid-modifying enzyme for exocytotic fusion (6,7,13). It contains two potential membrane association domains, namely a pleckstrin homology (PH) domain and a phox homology (PX) domain; both of them are required for recruitment to the plasma membrane (24).…”