Phosphorylation of ORF1p is required for L1 retrotransposition

Abstract

Although members of the L1 (LINE-1) clade of non-LTR retrotransposons can be deleterious, the L1 clade has remained active in most mammals for ∼100 million years and generated almost 40% of the human genome. The details of L1-host interaction are largely unknown, however. Here we report that L1 activity requires phosphorylation of the protein encoded by the L1 ORF1 (ORF1p). Critical phospho-acceptor residues (two serines and two threonines) reside in four conserved proline-directed protein kinase (PDPK) target sites. The PDPK family includes mitogen-activated protein kinases and cyclin-dependent kinases. Mutation of any PDPK phospho-acceptor inhibits L1 retrotransposition. The phosphomimetic aspartic acid can restore activity at the two serine sites, but not at either threonine site, where it is strongly inhibitory. ORF1p also contains conserved PDPK docking sites, which promote specific interaction of PDPKs with their targets. As expected, mutations in these sites also inhibit L1 activity. PDPK mutations in ORF1p that inactivate L1 have no significant effect on the ability of ORF1p to anneal RNA in vitro, an important biochemical property of the protein. We show that phosphorylated PDPK sites in ORF1p are required for an interaction with the peptidyl prolyl isomerase 1 (Pin1), a critical component of PDPK-mediated regulation. Pin1 acts via isomerization of proline side chains at phosphorylated PDPK motifs, thereby affecting substrate conformation and activity. Our demonstration that L1 activity is dependent on and integrated with cellular phosphorylation regulatory cascades significantly increases our understanding of interactions between L1 and its host.L 1 (or LINE-1) activity over the last ∼100 million years of primate evolution has generated ∼40% of the human genome (1, 2); thus, succeeding families of L1 elements are the main drivers of genetic expansion. These autonomously replicating elements convert their RNA transcripts and those of other genetic elements, particularly SINEs, into genomic DNA (3). A generic L1 element is 6-7 kb and contains the following: a 5′ UTR; ORF1, which encodes the coiled-coil mediated trimeric nucleic acid chaperone protein ORF1p; ORF2, which encodes a DNA endonuclease and reverse-transcriptase ORF2p; and a 3′ UTR terminated in a polyA sequence (reviewed in refs. 3 and 4). ORF1p, ORF2p, and L1 RNA form ribonucleoprotein particles (RNPs) that are likely intermediates in L1 retrotransposition (5-8). The L1-encoded proteins ORF1p and ORF2p are essential in cell culture-based retrotransposition assays (9) and in vitro assays using RNPs from cells transfected with L1 retrotransposition vectors (7). Although the role of ORF1p in retrotransposition is not known, mutations that affect its nucleic acid binding and chaperone activities can inactivate L1 (7, 9, 10).L1 activity can damage DNA (11), can generate genetic diversity and rearrangements (12-16), and is activated in certain tumors (17-19) and other somatic cells (20), including neuronal cells (21-23). Despite being deleterious (2...

The Evolution of Line-1 in Vertebrates

“…9), the three amino acids forming the conserved salt bridge that stabilize the structure of ORF1p (orange arrows) and the residues providing RNA-binding side chains (green arrows) (Khazina and Weichenrieder 2009). In addition, several motifs involved in the phosphorylation of ORF1p (Cook et al 2015) are conserved, although never across all families (fig. 9).…”

“…ORF1 contains a coiled-coil domain (CCD), which promotes the formation of ORF1p trimers, a non-canonical RNA recognition motif (RRM) and a highly conserved C-terminus domain (Martin and Bushman 2001; Martin et al 2003; Januszyk et al 2007; Khazina and Weichenrieder 2009). The function of ORF1 remains obscure but it has been shown to have nucleic acid chaperone activity (Martin and Bushman 2001) and recent studies showed that the human ORF1p requires phosphorylation for retrotransposition in a cell culture-based assay (Cook et al 2015). ORF1p participate in the formation of L1 ribonucleoprotein particles (RNP), which is a necessary step of the transposition process (Kolosha and Martin 1997; Kulpa and Moran 2005).…”

Deciphering fact from artifact when using reporter assays to investigate the roles of host factors on L1 retrotransposition

“…We first determined whether activated wild type p38δ (WT, Invitrogen) could phosphorylate ORF1p on its S/T-P motifs, which are required for robust L1 activity [31]. In vitro radioactive kinase assays revealed that p38δ-WT exclusively phosphorylated bacterially purified ORF1p on these residues, as an ORF1p carrying mutations at all four motifs, S18A/S27A/T203G/T213G (AAGG), was not phosphorylated (Fig.…”

“…The resulting clone was designated pET32aΔN. Full-length ORF1 PCR-generated amplicons were created from the previously described pORF1-Flag mammalian expression vector [31] using a high-fidelity DNA polymerase with the forward primer 5′CGCGGATCCATGGGGAAAAAACAGAACAG containing a 5′ BamH1 site, and reverse primer 5′GCCGGAATTCGCCGCCGCCCATTTTGGCATGATTTTGC, which introduced a spacer of three glycines between the end of ORF1 and the 3′ EcoRI sequence (the Flag sequence was not retained). The ORF1p amplicon was inserted into pET32aΔN via the BamH1 and EcoRI sites.…”

“…Recent work has thus been aimed at identifying cellular host factors required for L1 expression, repression and reactivation. With respect to this, our laboratory recently demonstrated that host proline-directed protein kinase (s) (PDPKs) phosphorylate the L1 protein ORF1p on multiple PDPK motifs required for L1 retrotransposition [31]. …”