Phylogenetic analysis of Dermatophilus congolensis isolated from naturally infected cattle in Abeokuta and Ilorin, Nigeria

Abstract

Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae. In this study, molecular tools were applied to suspected isolates of D. congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D. congolensis was carried out using the QIAamp® DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D. congolensis using 5′‐ACATGCAAGTCGAACGATGA‐3′ and 5′‐ACGCTCGCACCCTACGTATT‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D. congolensis isolates had between 94% to 99% homology with the sequences of D. congolensis satellite DNA in GenBank. This result also revealed that the sequenced D. congolensis are of different strains. Phylogenetic analysis revealed that D. congolensis, though closely related to Nocardia brasiliensis (NR 074743.01) and Streptomyces sp. (JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D. congolensis. It can also be concluded that two strains of D. congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D. congolensis not yet listed in GenBank.

Isolation and Identification of Nitrogen-Fixing Rhizobacteria associated with Cocoa plantation (Theobroma cacao L) as Biofertilizer Agent

“…It is also closely related to the organic matter content of the soil, especially the level of decomposition (C/N) [16,17]. The rhizosphere C/N ratio of cocoa plants was 10.70 in this study, and the C/N ratio of the soil type of cocoa was low. It is because some of the available N is used by microorganisms in the breakdown of organic matter [18].…”

“…The 16S rDNA sequences were edited using the Sequencer Scanner V.1 program and combined using the CAP Contig Assembly in the BioEdit V.7.2 program. 16S rDNA sequences were BLAST using the NCBI BLASTN program, and nucleotide sequences were determined according to GenBank [10]. The isolated 16S rDNA sequences and the reference strain were aligned with the ClustalW Multiple Alignment program MEGA 11.…”

Dermatophilus congolensis infection in sheep and goats in Delta region of Tamil Nadu

“…[ 5 ], and Oladunni et al . [ 16 ]. The 16S ribosomal RNA gene has been found useful in the diagnosis of many bacterial organisms because of the highly conserved nature of this gene in most of the bacterial organisms.…”

Identification and Antimicrobial Resistance of Dermatophilus congolensis from Cattle in Saint Kitts and Nevis

“…Dermatophilus congolensis is a facultatively anaerobic actinomycete that can infect a wide range of animals as well as humans, leading to the skin disease dermatophilosis, also commonly referred to as mycotic dermatitis (erroneously as it is not a mycosis), rain rot, rain scald or streptotrichosis [ 1 , 2 , 3 , 4 ]. The acute form of the disease is mainly localized in the epidermis and clinically manifests as purulent, crusted and matted hair masses formed as a direct result of the pustular process [ 2 ].…”