Abstract:Background
Eimeria tenella is the most pathogenic intracellular protozoan parasite of seven Eimeria species causing chicken coccidiosis around the world. This species is particularly responsible for caecal coccidiosis leading to serious morbidity–mortality and financial loss in poultry production.
Methods
The present study explored the genetic diversity of E. tenella. Litter slurry was collected from 18 broiler farms located in Mymensingh district, Bangladesh. Litter samples were processed for oocyst isolation… Show more
“…Notably, E. maxima and E. mitis were more closely related to each other than to E. praecox and E. acervulina , in contrast with findings based on the nuclear 18S and internal transcribed spacer (ITS) and mitochondrial cox 1 datasets [ 53 , 55 – 57 ]. Nevertheless, these analyses provided a consistent, robust phylogenetic resolution for the 33 isolates and their congeneric species in the genus Eimeria : a paraphyletic relationship was shared among the 10 chicken Eimeria species, in agreement with our genetic distance study herein and the results of morphological and molecular biology studies [ 6 , 56 , 58 – 60 ]. Fig.…”
Background
Coccidiosis caused by Eimeria is one of the most severe chicken diseases and poses a great economic threat to the poultry industry. Understanding the evolutionary biology of chicken Eimeria parasites underpins development of new interactions toward the improved prevention and control of this poultry disease.
Methods
We presented an evolutionary blueprint of chicken coccidia by genetically characterizing complete mitogenome assemblies of 33 isolates representing all seven known Eimeria species infecting chickens in China. Further genome- and gene-level phylogenies were also achieved to better understand the evolutionary relationships of these chicken Eimeria at the species level.
Results
33 mitogenomes of chicken eimerian parasites ranged from 6148 bp to 6480 bp in size and encoded typical mitochondrial compositions of apicomplexan parasites including three protein-coding genes (PCGs), seven fragmented small subunit (SSU) and 12/13 fragmented large subunit (LSU) rRNAs. Comparative genomics provided an evolutionary scenario for the genetic diversity of PCGs-cytochrome c oxidase subunits 1 and 3 (cox1 and cox3) and cytochrome b (cytb); all were under purifying selection with cox1 and cox3 being the lowest and highest evolutionary rates, respectively. Genome-wide phylogenies classified the 33 Eimeria isolates into seven subgroups, and furthermore Eimeria tenella and Eimeria necatrix were determined to be more closely related to each other than to the other eight congenic species. Single/concatenated mitochondrial protein gene-based phylogenies supported cox1 as the genetic marker for evolutionary and phylogenetic studies for avain coccidia.
Conclusions
To our knowledge, these are the first population-level mitogenomic data on the genus Eimeria, and its comprehensive molecular characterization provides valuable resources for systematic, population genetic and evolutionary biological studies of apicomplexan parasites in poultry.
Graphical Abstract
“…Notably, E. maxima and E. mitis were more closely related to each other than to E. praecox and E. acervulina , in contrast with findings based on the nuclear 18S and internal transcribed spacer (ITS) and mitochondrial cox 1 datasets [ 53 , 55 – 57 ]. Nevertheless, these analyses provided a consistent, robust phylogenetic resolution for the 33 isolates and their congeneric species in the genus Eimeria : a paraphyletic relationship was shared among the 10 chicken Eimeria species, in agreement with our genetic distance study herein and the results of morphological and molecular biology studies [ 6 , 56 , 58 – 60 ]. Fig.…”
Background
Coccidiosis caused by Eimeria is one of the most severe chicken diseases and poses a great economic threat to the poultry industry. Understanding the evolutionary biology of chicken Eimeria parasites underpins development of new interactions toward the improved prevention and control of this poultry disease.
Methods
We presented an evolutionary blueprint of chicken coccidia by genetically characterizing complete mitogenome assemblies of 33 isolates representing all seven known Eimeria species infecting chickens in China. Further genome- and gene-level phylogenies were also achieved to better understand the evolutionary relationships of these chicken Eimeria at the species level.
Results
33 mitogenomes of chicken eimerian parasites ranged from 6148 bp to 6480 bp in size and encoded typical mitochondrial compositions of apicomplexan parasites including three protein-coding genes (PCGs), seven fragmented small subunit (SSU) and 12/13 fragmented large subunit (LSU) rRNAs. Comparative genomics provided an evolutionary scenario for the genetic diversity of PCGs-cytochrome c oxidase subunits 1 and 3 (cox1 and cox3) and cytochrome b (cytb); all were under purifying selection with cox1 and cox3 being the lowest and highest evolutionary rates, respectively. Genome-wide phylogenies classified the 33 Eimeria isolates into seven subgroups, and furthermore Eimeria tenella and Eimeria necatrix were determined to be more closely related to each other than to the other eight congenic species. Single/concatenated mitochondrial protein gene-based phylogenies supported cox1 as the genetic marker for evolutionary and phylogenetic studies for avain coccidia.
Conclusions
To our knowledge, these are the first population-level mitogenomic data on the genus Eimeria, and its comprehensive molecular characterization provides valuable resources for systematic, population genetic and evolutionary biological studies of apicomplexan parasites in poultry.
Graphical Abstract
“…The isolated DNA samples were sent to the State Research Institute of Agricultural Microbiology (Pushkin, Russia) for analysis. 16S DNA libraries were composed using Ferier_F515 (5 -3 ) GTGCCAGCMGCCGCGGTAA and Ferier_R806 (5 -3 ) GGACTACVSGGGTATCTAAT primers [37], as described below.…”
Section: In Vitro Testing Of Grass Specimensmentioning
confidence: 99%
“…The visual examination of the inner organs of dead chickens after autopsy elucidated an edema and inflammation of the small intestine, and particularly the caeca in all birds. DNA was isolated from the ileum digesta and analyzed by PCR with primers EtF (AATTTAGTCCATCGCAACCCT) and EtR (CGAGCGCTCTGCATACGACA) specific to ITS-1 of the ribosome cluster [37]. The PCR was positive in the samples from six of the seven chickens that died in the NC group and in the single dead chicken from the experimental group KS2 (Table 4).…”
Section: Biological Trials Of the Additives On The Basis Of The Grass...mentioning
confidence: 99%
“…In parallel, the protective effect of the grass meal specimens against spontaneous invasion of the chickens with Eimeria tenella (coccidiosis) was studied. Molecular analysis by PCR with primers EtF and EtR specific to ITS-1 of the ribosome cluster [37] demonstrated the presence of this parasite in the ileum digesta of six chickens from seven dead in the negative control group in the course of the trials in the single dead chicken from experimental group KS2. One more chicken from the NC group, a chicken from the KS2 experimental group, and three chickens from the TS1 experimental group died in the course of the trials, as none of the chickens that survived until the end of the trials exhibited E. tenella DNA in the ileum digesta.…”
Probiotics can act as an alternative to antibiotics in animal feeding, but their use is minimal due to their expensive production. Dry grass is rich with bacteria beneficial for animal feeding and can be used as a probiotic. However, data about the quantitative dependence of the grass microbiome on environmental factors and seasons remain insufficient for preparing “grass-meal-based probiotics”. Four grass samples were collected in two geographically remote regions of Russia; their microbiome was characterized by metagenomic sequencing of 16S rDNA libraries and microbiological seeding, and biological testing of the grass meal was carried out on 6 groups of birds containing 20 Ross 308 cross broilers each for a period of 42 days. The positive control group (PC) obtained 16–25 mg/mL toltrazuril (coccidiostatic agent) and 0.5 mL/L liquid antibiotic enrostin (100 mg/mL ciprofloxacin and 106 MU/mL colistin sulfate in the commercial preparation) within the drinking water, while the negative control group (NC) obtained no medicines. Four experimental groups were fed the diet supplemented with 1% grass meal over the period of 7–42 days of life; no commercial medicines were used here. A spontaneous infection with Eimeria was registered in the NC control groups, which caused the loss of 7 chickens. No losses were registered in the PC group or the two experimental groups. In two other experimental groups, losses of coccidiosis amounted to 10% and 15%, respectively. All specimens of the grass meal demonstrated a significant effect on the average body weight gain compared to NC. Taken together, these observations support the hypothesis that the grass meal may substitute toltrazuril for protecting the chickens from parasitic invasion and increase average daily weight gain (ADG) as effectively as the antibiotic enrostin.
“…In addition, this industry is responsible for around 31 percent of the overall meat production in the country. According to Alam et al (2022), the chicken industry on a worldwide scale is a notable sub-sector within the area of agriculture. This sub-sector is distinguished by rapid expansion as well as large contributions to nutrition and food security.…”
Objective
The objective of the present research paper is to report the prevalence of clinical coccidiosis and identify different Eimeria species in suspected broilers in District Abbottabad.
Design:
The research study included a total of three hundred broiler samples. Out of these three hundred samples, 85 guts were found to be infected with Eimeria oocysts. The overall prevalence of coccidiosis was determined to be 28.3%, with 84.70% of cases being clinical coccidiosis and 15.29% being subclinical coccidiosis in District Abbottabad. Subjects: The subjects of the study were broilers, and a total of three hundred broiler samples were collected and analyzed. Innervation/Exposure: Five different Eimeria species were identified in the study area. The most prevalent species was E. tenella, accounting for 35.29% of the cases, followed by E. brunetti (22.35%), E. maxima (17.64%), E. necatrix (12.94%), and E. acervuline (11.76%). Main outcomes: The prevalence of coccidiosis was found to be influenced by the age of the broilers. The disease was more prevalent in broilers aged 22–42 days old, with a prevalence rate of 78.81%, while broilers aged 1–21 days old had a lower prevalence rate of 17.63%. Additionally, the highest predominance of coccidiosis infection was observed in August (33.69%) and September (37.5%) of 2022. Mortality and morbidity rates were also recorded, with 43.13% mortality and 73.40% morbidity in chicks aged 22–28 days old. The disease caused significant economic losses and poses a continued threat to farmers unless appropriate measures are taken.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
