Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofía; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martı́n; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

doi:10.1371/journal.pone.0111779

Cited by 83 publications

(87 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…In addition to high rates and positive selection of mutations in the viral capsid gene, previous studies have reported that genetic recombination has an important factor in the generation of viral diversity and the emergence of new genotypes (Wang et al, 2012;Pérez et al, 2014). However, we not observed evidence about recombination events in strains from Belém reported in this study.…”

Section: Discussioncontrasting

confidence: 86%

Research Article Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

Silva¹,

Silva²,

Rodrigues³

et al. 2017

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT. With the objective of characterizing Canine parvovirus (CPV) from some suspected fecal samples of dogs collected from the Veterinarian Hospital in Belém city, five positive samples were found by PCR assay and an update molecular characterization was provided of the CPV-2 circulation in Belém. Through sequencing of the complete DNA sequences (NS1, NS2, VP1, and VP2 genes), the CPV-2 strain was identified as CPV-2b (Asn426Asp) circulating in Belém. The CPV-2b strain with a different change at the position Tyr324Leu was detected in all samples assessed and thus reported for the first time for the scientific community. Phylogenetic analysis indicated that Belém CPV-2b and CPV-2a strains would be related to a cluster with samples 2 S.P. Silva et al. Genetics and Molecular Research 16 (3): gmr16039719after the 1990s, suggesting that CPV-2b in Belém originated from CPV2a circulating in Brazil after the 1990s. Potential recombination events were analyzed using RDP4 and SplitsTree4; therefore, results suggest that CPV-2 sequences here described were not potentially recombination events. Continuous monitoring and molecular characterization of CPV-2 samples are needed not only to identify possible genetic and antigenic changes that may interfere with the effectiveness of vaccines but also to bring a better understanding of the mechanisms that drive the evolution of CPV-2 in Brazil.

show abstract

Section: Discussioncontrasting

confidence: 86%

Research Article Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

Silva¹,

Silva²,

Rodrigues³

et al. 2017

Genet. Mol. Res.

View full text Add to dashboard Cite

show abstract

“…Comparison with VP2 sequences available in the GenBank database shows that this change occurred into CPV‐2a/CPV‐2b sequences from Asia (Chinchkar et al., ; Wu et al., ), Brazil (Pereira, Leal, & Durigon, ) and Europe (Cságola et al., ), including Italy (isolate CPV‐2a/151/212—accession n. ). The same mutation was also found in CPV‐2c strains collected in 2011‐2012 in Uruguay (Pérez et al., ) and Ecuador (Aldaz et al., ).…”

Section: Resultssupporting

confidence: 61%

“…Sequencing of the complete genome, encompassing both NS and VP genes, was carried out using primers pairs NS‐Fext (5′‐GACCGTTACTGACATTCGCTTC‐3′)/NS‐Rext (5′‐GAAGGGTTAGTTGGTTCTCC‐3′) and 2161F (5′‐TTGGCGTTACTCACAAAGACGTGC‐3′)/4835R (5′‐ACCAACCACCCACACCATAACAAC‐3′) (Pérez et al., ), using two separate reactions and the same reaction mix and thermal conditions described above. Amplicons were purified with Illustra™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare Life Sciences, Amersham, Buckinghamshire, UK) and submitted to BMR Genomics srl (Padova, Italy) for direct Sanger sequencing with additional internal primers: NS‐Fint (5′‐GTTGAAACCACAGTGACGACAG‐3′) for the PCR product amplified with primers pair NS‐Fext/NS‐Rext, R2 (5′‐TTTTGAATCCAATCTCCTTCTGGAT‐3′) and 3475R (5′‐GTTGGTGTGCCACTAGTTCCAGTA‐3′) for the product amplified with primers pair 2161F/4853R.…”

Section: Methodsmentioning

confidence: 99%

Introduction of Asian canine parvovirus in Europe through dog importation

Mira

Purpari

Lorusso

et al. 2017

Transbound Emerg Dis

View full text Add to dashboard Cite

Summary Canine parvovirus (CPV) is an important infectious agent of domestic and wild carnivores, responsible for severe and often fatal haemorrhagic gastroenteritis and leukopenia. This paper reports the genomic characterization of a CPV strain collected from a dog recently imported to Italy from Thailand. The virus was detected in all tissue samples collected. The whole genome encompassing the two open reading frames encoding for non‐structural (NS1/NS2) and structural (VP1/VP2) proteins was amplified and sequenced. On the basis of genetic analysis of the VP2 gene, the isolate was characterized as CPV‐2c, but it presented genetic signatures typical of Asian strains. Sequence analysis revealed the presence of amino acid changes never observed in European CPV‐2c strains (NS1: Ile60Val, Tyr544Phe, Glu545Val, Leu630Pro; VP2: Ala5Gly, Phe267Tyr, Tyr324Ile, Gln370Arg). By phylogenetic analysis of full‐length VP2 gene, the analysed strain clustered together with Asian viruses. Therefore, a possible introduction of the virus from Asia through the imported dog was suggested, thus confirming the important role of movement of dogs in the global spread of viruses. In addition, full‐length genome analysis could help better trace the spread of canine viruses through different continents.

show abstract

“…Limited studies are available on the CPV non‐structural genes (Hoelzer et al, ; Pérez et al, ), and, only recently, the analysis of the NS1 gene sequence was included in the CPV phylogenies from several countries (Canuti, Rodrigues, Whitney, & Lang, ; Grecco et al, ; Mira, Canuti, et al, ; Mira, Purpari, et al, ; Zhuang et al, ). In this study, sequence analysis revealed aa changes previously described mainly in NS1/NS2 gene sequences of CPV‐2a/2c strains of Asian origin.…”

Section: Discussionmentioning

confidence: 99%

“…By excluding the VP2 gene sequences with complete nt identities, 8 CPV DNAs from different cities of collection were further selected for a further sequence analysis by amplifying a long genome sequence encompassing both major ORFs, without the 5′ and 3′ flanking sequences (Table ). Sequence analyses were carried out using primer pairs described by Pérez et al (), using the commercial kit GoTaq ® G2 DNA Polymerase (Promega Italia s.r.l. ), as previously described (Mira, Dowgier, et al, ) with minor modifications (Mira, Canuti, et al, ).…”

Section: Methodsmentioning

confidence: 99%

Nearly full‐length genome characterization of canine parvovirus strains circulating in Nigeria

Ogbu

Mira

Purpari

et al. 2019

Transbound Emerg Dis

View full text Add to dashboard Cite

Canine parvovirus type 2 (CPV‐2) emerged suddenly in the late 1970s as pathogen of dogs, causing a severe and often fatal gastroenteric disease. The original CPV‐2 was replaced by three antigenic variants, CPV‐2a, CPV‐2b and CPV‐2c, which to date have gained a worldwide distribution with different relative proportions. All previous studies conducted in Africa were based on partial VP2 gene sequences. The aim of this study was to provide a genome analysis to characterize the CPV strains collected in Nigeria, Africa. Rectal swab samples (n = 320) were collected in 2018 and tested by means of an immunochromatographic assay. Among the 144 positive samples, 59 were selected for further analyses using different molecular assays. The results revealed a high prevalence of CPV‐2c (91.5%) compared to the CPV‐2a variant (8.5%). The VP2 gene sequences showed a divergence from the strains analysed in 2010 in Nigeria and a closer connection with CPV strains of Asian origin. The non‐structural gene analysis evidenced amino acid changes never previously reported. The molecular analysis based on genomic sequences evidenced a geographical pattern of distribution of the analysed strains, suggesting a potential common evolutionary origin with CPV of Asian origin. This study represents the first CPV molecular characterization including all the encoding gene sequences conducted in the African continent and contributes to define the current geographical spread of the CPV variants worldwide.

show abstract

Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

Cited by 83 publications

References 46 publications

Research Article Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

Research Article Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

Introduction of Asian canine parvovirus in Europe through dog importation

Nearly full‐length genome characterization of canine parvovirus strains circulating in Nigeria

Contact Info

Product

Resources

About