Phylogenetic Diversity and Microsphere Array-Based Genotyping of Human Pathogenic Fusaria, Including Isolates from the Multistate Contact Lens-Associated U.S. Keratitis Outbreaks of 2005 and 2006

O’Donnell, Kerry; Sarver, Brice A. J.; Brandt, Mary E.; Chang, Douglas C.; Noble-Wang, Judith; Park, Benjamin J.; Sutton, Deanna A.; Benjamin, Lynette; Lindsley, Mark D.; Padhye, A. A.; Geiser, David M.; Ward, Todd J.

doi:10.1128/jcm.00533-07

Cited by 282 publications

(220 citation statements)

References 42 publications

Supporting

Mentioning

209

Contrasting

Unclassified

Order By: Relevance

“…Primers for molecular identification and phylogenetic analysis Primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used to amplify the ITS fragment (approximately 600 bp), primers EF1 (ATGGGTAAGGARGACAAGAC) and EF2 (GGARGTACCAGTSATCATGTT) were used to amplify a nearly 720 bp fragment of the coding gene for EF-1α, primers RPB2-5F (GAYGAYMGWGATCAYTTYGG) and RPB2-7R (CCCATWGCYTGCTTMCCCAT) were used to amplify a nearly 1200 bp fragment of the coding gene for RPB2 O'Donnell et al 2007, O'Donnell et al 2008Short et al 2011;Zhang et al 2006). DNA extraction and polymerase chain reaction DNA was extracted using a manual purification procedure as described (Papizadeh et al 2017a,;Saba et al 2016).…”

Section: Growth Ratesmentioning

confidence: 99%

“…For amplification of the selected fragment of the RPB2 gene the PCR conditions included: (1) hot start with 95°C for 5 min; (2) 30 cycles of 1 min at 95°C, 2 min at 55°C (or 50°C), an increase of 1°C/5 s to 72°C, and 2 min at 72°C; and (3) a 10-min incubation at 72°C, respectively. The PCR products were sequenced by Genfanavaran Biotech Corporation (O'Donnell et al 2007). The DNA sequences determined for this study were submitted to GenBank, and the accession numbers for strain CBS 115.40 = IBRC-M 30232 are: KX503270 (RPB2), KX503269 (EF-1α), KX503267 (ITS).…”

Section: Growth Ratesmentioning

confidence: 99%

See 1 more Smart Citation

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

et al. 2018

View full text Add to dashboard Cite

Two Fusarium strains, isolated from Asparagus in Italy and Musa in Vietnam respectively, proved to be members of an undescribed clade within the Fusarium solani species complex based on phylogenetic species recognition on ITS, partial RPB2 and EF-1α gene fragments. Macro-and micro-morphological investigations followed with physiological studies done on this new species: Fusarium ershadii sp. nov can be distinguished by its conidial morphology. Both isolates of Fusarium ershadii were shown to be pathogenic to the monocot Asparagus officinalis when inoculated on roots and induced hollow root symptoms within two weeks in Asparagus officinalis seedlings. In comparison mild disease symptoms were observed by the same strains on Musa acuminata seedlings.

show abstract

Section: Growth Ratesmentioning

confidence: 99%

Section: Growth Ratesmentioning

confidence: 99%

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Molecular phylogenetic studies of medically important fusaria have revealed that the more commonly reported pathogens (i.e., F. solani, F. oxysporum, F. moniliforme, F. incarnatum, F. chlamydosporum, and F. dimerum) actually comprise species complexes that collectively contain at least 70 species (15,(21)(22)(23)(24)(25)(26). Since the majority of fusarial isolates cannot be identified to species level by traditional morphological methods only (errors in identification, Ϸ33 to 50%), which greatly underestimate species diversity (19,22,24), DNA sequence-based molecular tools are increasingly used to enable accurate species determination (4,27).…”

mentioning

confidence: 99%

Accurate and Practical Identification of 20 Fusarium Species by Seven-Locus Sequence Analysis and Reverse Line Blot Hybridization, and an In Vitro Antifungal Susceptibility Study

Xiao

Kong

et al. 2011

J Clin Microbiol

View full text Add to dashboard Cite

Eleven reference and 25 clinical isolates of Fusarium were subject to multilocus DNA sequence analysis to determine the species and haplotypes of the fusarial isolates from Beijing and Shandong, China. Seven loci were analyzed: the translation elongation factor 1 alpha gene (EF-1␣); the nuclear rRNA internal transcribed spacer (ITS), large subunit (LSU), and intergenic spacer (IGS) regions; the second largest subunit of the RNA polymerase gene (RPB2); the calmodulin gene (CAM); and the mitochondrial small subunit (mtSSU) rRNA gene. We also evaluated an IGS-targeted PCR/reverse line blot (RLB) assay for species/haplotype identification of Fusarium. Twenty Fusarium species and seven species complexes were identified. Of 25 clinical isolates (10 species), the Gibberella (Fusarium) fujikuroi species complex was the commonest (40%) and was followed by the Fusarium solani species complex (FSSC) (36%) and the F. incarnatum-F. equiseti species complex (12%). Six FSSC isolates were identified to the species level as FSSC-3؉4, and three as FSSC-5. Twenty-nine IGS, 27 EF-1␣, 26 RPB2, 24 CAM, 18 ITS, 19 LSU, and 18 mtSSU haplotypes were identified; 29 were unique, and haplotypes for 24 clinical strains were novel. By parsimony informative character analysis, the IGS locus was the most phylogenetically informative, and the rRNA gene regions were the least. Results by RLB were concordant with multilocus sequence analysis for all isolates. Amphotericin B was the most active drug against all species. Voriconazole MICs were high (>8 g/ml) for 15 (42%) isolates, including FSSC. Analysis of larger numbers of isolates is required to determine the clinical utility of the seven-locus sequence analysis and RLB assay in species classification of fusaria.

show abstract

“…Recently, at least 300 phylogenetically distinct species were estimated (O'Donnell et al, 2015). O'Donnell et al (2004O'Donnell et al ( , 2007 and Zhang et al (2006) reported that fusaria pathogenic to humans and other animals belong to either the FSSC or FOSC clade. In light of the conclusion by Dupont et al (2007) regarding the Lascaux Cave, we suggested that most TT and KT fusaria in the FSSC clade 3 were also deeply involved in the deterioration of the murals .…”

Section: -1 Fusarium Solani Species Complex (Fssc) Cladementioning

confidence: 99%

Polyphasic insights into the microbiomes of the Takamatsuzuka Tumulus and Kitora Tumulus

Sugiyama¹,

Kiyuna²,

Nishijima³

et al. 2017

J. Gen. Appl. Microbiol.

View full text Add to dashboard Cite

Microbial outbreaks and related biodeterioration problems have affected the 1300-year-old multicolor (polychrome) mural paintings of the special historic sites Takamatsuzuka Tumulus (TT) and Kitora Tumulus (KT). Those of TT are designated as a national treasure. The microbiomes of these tumuli, both located in Asuka village, Nara, Japan, are critically reviewed as the central subject of this report. Using culture-dependent methods (conventional isolation and cultivation), we conducted polyphasic studies of the these microbial communities and identified the major microbial colonizers (Fusarium spp., Trichoderma spp., Penicillium spp., dark Acremonium spp., novel Candida yeast spp., Bacillus spp., Ochrobactrum spp., Stenotrophomonas tumulicola, and a few actinobacterial genera) and noteworthy microbial members (Kendrickiella phycomyces, Cephalotrichum verrucisporum (∫ ∫ ∫ ∫ ∫Doratomyces verrucisporus), Sagenomella striatispora, Sagenomella griseoviridis, two novel Cladophialophora spp., Burgoa anomala, one novel species Prototheca tumulicola, five novel Gluconacetobacter spp., three novel Bordetella spp., and one novel genus and species Krasilnikoviella muralis) involved in the biodeterioration of mural paintings, plaster walls, and stone chamber interiors. In addition, we generated microbial community data from TT and KT samples using cultureindependent methods (molecular biological methods, including PCR-DGGE, clone libraries, and pyrosequence analysis). These data are comprehensively presented, in contrast to those derived from culture-dependent methods. Furthermore, the microbial communities detected using both methods are analytically compared, and, as a result, the complementary roles of these methods and approaches are highlighted. In related contexts, knowledge of similar biodeterioration problems affecting other prehistoric cave paintings, mainly at Lascaux in France and Altamira in Spain, are referred to and commented upon. Based on substrate preferences (or ecological grouping) and mapping (plotting detection sites of isolates), we speculate on the possible origins and invasion routes whereby the major microbial colonizers invaded the TT stone chamber interior. Finally, concluding remarks, lessons, and future perspectives based on our microbiological surveys of these ancient tumuli, and similar treasures outside of Japan, are briefly presented. A list of the microbial taxa that have been identified and fully or briefly described by us as known and novel taxa for TT and KT isolates since 2008 is presented in Supplementary Materials. 64SUGIYAMA et al.

show abstract

Phylogenetic Diversity and Microsphere Array-Based Genotyping of Human Pathogenic Fusaria, Including Isolates from the Multistate Contact Lens-Associated U.S. Keratitis Outbreaks of 2005 and 2006

Cited by 282 publications

References 42 publications

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

Fusarium ershadii sp. nov., a Pathogen on Asparagus officinalis and Musa acuminata

Accurate and Practical Identification of 20 Fusarium Species by Seven-Locus Sequence Analysis and Reverse Line Blot Hybridization, and an In Vitro Antifungal Susceptibility Study

Polyphasic insights into the microbiomes of the Takamatsuzuka Tumulus and Kitora Tumulus

Contact Info

Product

Resources

About