Placenta and Placental Transport Function

Sadovsky, Yoel; Jansson, Thomas

doi:10.1016/b978-0-12-397175-3.00039-9

Cited by 16 publications

(11 citation statements)

References 325 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Transgenic lines were maintained as hemizygotes by breeding with WT C57BL/6 mice and were genotyped by using standard PCR (set 1: forward: GTGCGGGCCTCTTCGCTATTACGCCAGCTG, reverse: TGCAGGTCGACTCTAGAGGATCCCCGGGTA; set 2: forward: AGTGTCACCTAAATAGCTTGGCGTAATCAT, reverse: TGAATTACAACAGTACTGCGATGAGTGGCA). The following 4 groups of nonpregnant mice were used for analysis at 8–12 wk (1): WT males (2), C19MC transgenic males (3), WT females (4), C19MC transgenic females. Timed breeding was carried out to obtain pregnant dams by using crossings between either WT females with C19MC transgenic males or C19MC transgenic females with WT males.…”

Section: Methodsmentioning

confidence: 99%

“…In both the human and mouse placenta, the trophoblast is located in direct contact with the maternal blood and mediates the crucial exchange of gases, nutrients, and waste products between the mother and fetus (1, 2). Previously thought to be a passive barrier, it is now clear that the trophoblast actively orchestrates an extensive repertoire of signals that are designed to optimize placental transport functions, produce crucial hormones, and immunologically protect the developing fetus (3). It is also known that the placenta releases DNA and RNA molecules of fetal origin into the maternal circulation, which offers a noninvasive means to prenatally assess the fetal genome and health (4).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Expression and trafficking of placental microRNAs at the feto‐maternal interface

et al. 2017

Self Cite

View full text Add to dashboard Cite

During pregnancy, placental trophoblasts at the feto-maternal interface produce a broad repertoire of microRNA (miRNA) species. These species include miRNA from the primate-specific chromosome 19 miRNA cluster (C19MC), which is expressed nearly exclusively in the placenta. Trafficking of these miRNAs among the maternal, placental, and fetal compartments is unknown. To determine miRNA expression and trafficking patterns during pregnancy, we sequenced miRNAs in triads of human placenta and of maternal and fetal blood and found large subject-to-subject variability, with C19MC exhibiting compartment-specific expression. We therefore created humanized mice that transgenically express the entire 160-kb human C19MC locus or lentivirally express C19MC miRNA members selectively in the placenta. C19MC transgenic mice expressed a low level of C19MC miRNAs in diverse organs. When pregnant, female C19MC mice exhibited a strikingly elevated (>40-fold) expression of C19MC miRNA in the placenta, compared with other organs, that resembled C19MC miRNAs patterns in humans. Our mouse models showed that placental miRNA traffic primarily to the maternal circulation and that maternal miRNA can traffic to the placenta and even into the fetal compartment. These findings define an extraordinary means of nonhormonal, miRNA-based communication between the placenta and feto-maternal compartments.-Chang, G., Mouillet, J.-F., Mishima, T., Chu, T., Sadovsky, E., Coyne, C. B., Parks, W. T., Surti, U., Sadovsky, Y. Expression and trafficking of placental microRNAs at the feto-maternal interface.

show abstract

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

Expression and trafficking of placental microRNAs at the feto‐maternal interface

et al. 2017

Self Cite

View full text Add to dashboard Cite

show abstract

“…The basic exchange unit of the human placenta is the villus, where trophoblasts (including the syncytiotrophoblasts and the subjacent cytotrophoblasts) that line the villous surface are directly bathed in maternal blood. Other major components of the villous core include fibroblasts, endothelial cells and Hofbauer macrophages [ 21 , 22 ]. In addition to pregnancy-related hormones and growth factors, recent data suggest that maternal-foetal communication in the form of sEVs plays an important role in many homeostatic functions [ 23 – 25 ].…”

Section: Introductionmentioning

confidence: 99%

Internalization of trophoblastic small extracellular vesicles and detection of their miRNA cargo in P‐bodies

Pinilla-Macua

Ouyang

et al. 2020

J of Extracellular Vesicle

Self Cite

View full text Add to dashboard Cite

Pregnancy is a unique situation, in which placenta-derived small extracellular vesicles (sEVs) may communicate with maternal and foetal tissues. While relevant to homoeostatic and pathological functions, the mechanisms underlying sEV entry and cargo handling in target cells remain largely unknown. Using fluorescently or luminescently labelled sEVs, derived from primary human placental trophoblasts or from a placental cell line, we interrogated the endocytic pathways used by these sEVs to enter relevant target cells, including the neighbouring primary placental fibroblasts and human uterine microvascular endothelial cells. We found that trophoblastic sEVs can enter target cells, where they retain biological activity. Importantly, using a broad series of pharmacological inhibitors and siRNA-dependent silencing approaches, we showed that trophoblastic sEVs enter target cells using macropinocytosis and clathrin-mediated endocytosis pathways, but not caveolin-dependent endocytosis. Tracking their intracellular course, we localized the sEVs to early endosomes, late endosomes, and lysosomes. Finally, we used coimmunoprecipitation to demonstrate the association of the sEV microRNA (miRNA) with the P-body proteins AGO2 and GW182. Together, our data systematically detail endocytic pathways used by placental sEVs to enter relevant fibroblastic and endothelial target cells, and provide support for "endocytic escape" of sEV miRNA to P-bodies, a key site for cytoplasmic RNA regulation.

show abstract

“…At all gestational ages, foetal chloride concentration is 5 mmol/L higher than in maternal blood. Chloride transport mechanisms across the human placenta have been characterised, although the physiological roles of the chloride transporters and channels remain unclear (Riquelme, ; Sadovsky and Jansson, ).…”

Section: Criteria (Endpoints) On Which To Base Dietary Reference Valuesmentioning

confidence: 99%

Dietary reference values for chloride

Turck

Castenmiller²,

Henauw

et al. 2019

EFS2

View full text Add to dashboard Cite

Following a request from the European Commission, the EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA) has derived dietary reference values (DRVs) for chloride. There are no appropriate biomarkers of chloride status, no balance studies and no adequate evidence on the relationship between chloride intake and health outcomes that can be used to set DRVs for chloride. There is a close relationship between sodium and chloride balances in the body. Sodium chloride is the main source of both electrolytes in European diets and similar urinary excretion levels of sodium and chloride (on a molar basis) are typically observed in Western populations. Hence, the Panel considered that reference values for chloride can be set at values equimolar to the reference values for sodium for all population groups, and are as follows: 1.7 g/day for children aged 1–3 years, 2.0 g/day for children aged 4–6 years, 2.6 g/day for children aged 7–10 years, 3.1 g/day for children aged 11–17 years and 3.1 g/day for adults including pregnant and lactating women. Consistent with the reference values for sodium, these levels of chloride intake are considered to be safe and adequate for the general EU population, under the consideration that the main dietary source of chloride intake is sodium chloride. For infants aged 7–11 months, an adequate intake of 0.3 g/day is set.

show abstract

Placenta and Placental Transport Function

Cited by 16 publications

References 325 publications

Expression and trafficking of placental microRNAs at the feto‐maternal interface

Expression and trafficking of placental microRNAs at the feto‐maternal interface

Internalization of trophoblastic small extracellular vesicles and detection of their miRNA cargo in P‐bodies

Dietary reference values for chloride

Contact Info

Product

Resources

About