Plasmodium vivax merozoite surface protein PvMSP-3β is radically polymorphic through mutation and large insertions and deletions

Rayner, Julian C.; Huber, Curtis S.; Feldman, Daniel D.; Ingravallo, Paul; Galinski, Mary R.; Barnwell, John W.

doi:10.1016/j.meegid.2004.03.003

Cited by 53 publications

(80 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…20,22,23 In the PvMSP1P sequences, the E/Q-rich region was shown to be highly polymorphic (21 allelic types in 127 clones/isolates). In the cases of PvMSP1 and Pfs230 (AF269242), the E/Q-rich region was also highly polymorphic and represented the principal source of genetic diversity.…”

Section: Discussionmentioning

confidence: 99%

Genetic Polymorphism of Plasmodium vivax msp1p, a Paralog of Merozoite Surface Protein 1, from Worldwide Isolates

Wang¹,

Kaneko²,

Sattabongkot³

et al. 2011

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Plasmodium vivax msp1p, a paralog of the candidate vaccine antigen P. vivax merozoite surface protein 1, possesses a signal peptide at its N-terminus and two epidermal growth factor–like domains at its C-terminus with a glycosylphosphatidylinositol attachment site. The msp1p gene locus may have originated by a duplication of the msp1 gene locus in a common ancestor of the analyzed Plasmodium species and lost from P. yoelii, P. berghei, and P. falciparum during their evolutionary history. Full-length sequences of the msp1p gene were generally highly conserved; they had a few amino acid substitutions, one highly polymorphic E/Q-rich region, and a single-to-triple hepta-peptide repeat motif. Twenty-one distinguishable allelic types (A1–A21) of the E/Q-rich region were identified from worldwide isolates. Among them, four types were detected in isolates from South Korea. The length polymorphism of the E/Q-rich region might be useful as a genetic marker for population structure studies in malaria-endemic areas.

show abstract

Section: Discussionmentioning

confidence: 99%

Genetic Polymorphism of Plasmodium vivax msp1p, a Paralog of Merozoite Surface Protein 1, from Worldwide Isolates

Wang¹,

Kaneko²,

Sattabongkot³

et al. 2011

The American Society of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

show abstract

“…Based on published PvMSP3β sequences (Galinski et al, 2001;Rayner et al, 2004) and those obtained from 58 Thai isolates (Cui, unpublished), we designed primers from the conserved sequences to amplify the 5′ region of the gene containing most of the insertions/deletions. Primary PCR of PvMSP3β was performed in 20 μl using 3 μl of DNA using primers F1 (5′ GGTATTCTTCGCAACACTC 3′) and R1 (5′ GCTTCTGATGTTATTTCCAG 3′).…”

Section: Pcr Of Pvmsp3β Genesmentioning

confidence: 99%

“…Although PfMSP3 has limited sequence polymorphism (McColl et al, 1994;McColl and Anders, 1997;Huber et al, 1997), PvMSP3α and β genes are highly polymorphic (Rayner et al, 2002(Rayner et al, ,2004Mascorro et al, 2005,Ord et al, 2005. Molecular evolution studies suggest that extensive polymorphism of PvMSP3α is probably generated by intragenic recombinations and maintained by balancing selection (Rayner et al, 2002;Mascorro et al, 2005;Ord et al, 2005).…”

Section: Introductionmentioning

confidence: 99%

“…Molecular evolution studies suggest that extensive polymorphism of PvMSP3α is probably generated by intragenic recombinations and maintained by balancing selection (Rayner et al, 2002;Mascorro et al, 2005;Ord et al, 2005). Likewise, PvMSP3β sequences from P. vivax global isolates are also radically divergent with the majority bearing large insertion/deletion mutations in the central Ala-rich region (Rayner et al, 2004). In this report, we have employed the polymorphic nature of PvMSP3β gene and developed a PCR/ RFLP method for genotyping P. vivax isolates, which could distinguish 12 alleles within three Asian parasite populations.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

et al. 2006

View full text Add to dashboard Cite

The recent resurgence of Plasmodium vivax malaria requires close epidemiological surveillance and monitoring of the circulating parasite populations. In this study, we developed a combination of polymerase chain reaction and restriction fragment length polymorphism (PCR/RFLP) method to investigate the genetic diversity of the P. vivax merozoite surface protein 3β (PvMSP3β) gene among four Asian parasite populations representing both tropical and temperate strains with dramatic divergent relapse patterns (N = 143). Using P. vivax field isolates from symptomatic patients, we have validated the feasibility of this protocol in distinguishing parasite genotypes. We have shown that PCR alone could detect three major size polymorphisms of the PvMSP3β gene, and restriction analysis detected a total of 12 alleles within these Asian samples. Samples from different geographical areas differed dramatically in their PvMSP3β allele composition and frequency, indicating that complex, yet different parasite genotypes were circulating in different endemic areas. This protocol allowed easy detections of multiple infections, which reached 20.5% in the samples from Thailand. It is interesting to note that samples from one temperate site in China collected during a recent outbreak of the disease also showed a high level of genetic diversity with multiple infections accounting for 5.6% of the samples. When combined with the PvMSP3α locus, this method provides better capability in distinguishing P. vivax genotypes and detecting mixed genotype infections.

show abstract

“…Investigation of PvMsp-3b diversity was by cloning and sequencing full-length gene fragments from fifteen P. vivax isolates originating from Asia, South America and the Pacific region. PvMsp-3a and PvMsp-3b are extremely polymorphic paralogs with multiple gene sizes and sequences present in the different isolates (Rayner et al 2004). Two proteins, recently described in P. falciparum, MSP-4 and MSP-5, are found in tandem on chromosome 2 with the synthetic region of the genome being identified in rodent malaria.…”

Section: Mspmentioning

confidence: 99%

The genetic diversity of Plasmodium vivax: a review

Souza-Neiras

Melo

Machado

2007

Mem. Inst. Oswaldo Cruz

View full text Add to dashboard Cite

Plasmodium vivax merozoite surface protein PvMSP-3β is radically polymorphic through mutation and large insertions and deletions

Cited by 53 publications

References 31 publications

Genetic Polymorphism of Plasmodium vivax msp1p, a Paralog of Merozoite Surface Protein 1, from Worldwide Isolates

Genetic Polymorphism of Plasmodium vivax msp1p, a Paralog of Merozoite Surface Protein 1, from Worldwide Isolates

Genetic structures of geographically distinct Plasmodium vivax populations assessed by PCR/RFLP analysis of the merozoite surface protein 3β gene

The genetic diversity of Plasmodium vivax: a review

Contact Info

Product

Resources

About