Pluripotentiality and Conditional Transgene Regulation in Human Embryonic Stem Cells Expressing Insulated Tetracycline-ON Transactivator

Vieyra, Diego; Goodell, Margaret A.

doi:10.1634/stemcells.2007-0248

Cited by 36 publications

(32 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the first step, the undifferentiated (UD) cells were transduced with lentivirus containing pLTET-Math1. In this lentivector, the TRET promoter allows doxycycline-dependant control of the Math1 gene and the strong mammalian promoter EF1a constitutively drives the expression of DsRedEX, a variant of red fluorescent protein with increased solubility and faster maturation [13]. Passage 11 cells were plated at a density of 8 Â 10 4 per well in a gelatin-coated 96-well plate and allowed to grow for 20 hours.…”

Section: Generation Of the Math1-inducible Esc Linementioning

confidence: 99%

Conditional Induction of Math1 Specifies Embryonic Stem Cells to Cerebellar Granule Neuron Lineage and Promotes Differentiation into Mature Granule Neurons

et al. 2013

View full text Add to dashboard Cite

Directing differentiation of embryonic stem cells (ESCs) to specific neuronal subtype is critical for modeling disease pathology in vitro. An attractive means of action would be to combine regulatory differentiation factors and extrinsic inductive signals added to the culture medium. In this study, we have generated mature cerebellar granule neurons by combining a temporally controlled transient expression of Math1, a master gene in granule neuron differentiation, with inductive extrinsic factors involved in cerebellar development. Using a Tetracyclin-On transactivation system, we overexpressed Math1 at various stages of ESCs differentiation and found that the yield of progenitors was considerably increased when Math1 was induced during embryonic body stage. Math1 triggered expression of Mbh1 and Mbh2, two target genes directly involved in granule neuron precursor formation and strong expression of early cerebellar territory markers En1 and NeuroD1.Three weeks after induction, we observed a decrease in the number of glial cells and an increase in that of neurons albeit still immature. Combining Math1 induction with extrinsic factors specifically increased the number of neurons that expressed Pde1c, Zic1, and GABAa6R characteristic of mature granule neurons, formed ''T-shaped'' axons typical of granule neurons, and generated synaptic contacts and action potentials in vitro. Finally, in vivo implantation of Math1-induced progenitors into young adult mice resulted in cell migration and settling of newly generated neurons in the cerebellum. These results show that conditional induction of Math1 drives ESCs toward the cerebellar fate and indicate that acting on both intrinsic and extrinsic factors is a powerful means to modulate ESCs differentiation and maturation into a specific neuronal lineage. STEM CELLS 2013;31:652-665 Disclosure of potential conflicts of interest is found at the end of this article.

show abstract

Section: Generation Of the Math1-inducible Esc Linementioning

confidence: 99%

Conditional Induction of Math1 Specifies Embryonic Stem Cells to Cerebellar Granule Neuron Lineage and Promotes Differentiation into Mature Granule Neurons

et al. 2013

View full text Add to dashboard Cite

show abstract

“…21 To generate vector pLTRET-hsa-miRs-126/126*, a fragment coding luciferase within pLTRET-Luc was released and replaced with genomic sequence coding hsa-miRs-126/126*. Primers for cloning miRs-126/126*: TAATGGATCCGGAATCTGGGCGGAAGGCGGTG; ATAAGAATGCG-GCCGCATCGATAGAGCCAGAAGACTCAGGCCCAG; DNA fragment coding hsa-miRs-126/126* contains 185 bp upstream and 179 bp downstream from the miRs-126/126* precursor.…”

Section: Construction Of Lentiviral Vectors and Production Of Lentivirusmentioning

confidence: 99%

Regulated expression of microRNAs-126/126* inhibits erythropoiesis from human embryonic stem cells

Huang

Gschweng

Handel

et al. 2011

Blood

View full text Add to dashboard Cite

IntroductionThe hematopoietic system is hierarchically organized, with a rare population of hematopoietic stem cells giving rise to specific progenitor cells and ultimately to diverse mature blood cell types. Lineage-specific fate decisions are intricately controlled by sets of master transcription factors. 1 For example, erythroid versus myeloid lineage differentiation is based on transcriptional crossantagonism between GATA-1 and PU.1. 2 PU.1 and C/EBP␣ are required for the generation of both macrophages and neutrophils. 3 In addition to transcription factors that are pivotal for hematopoietic cell lineage specification, several developmentally conserved signaling pathways, including Notch, Wnt, Sonic hedgehog, and TGF-␤, have also been implicated in regulating lineage determination. 4 MicroRNAs (miRs) are a recently discovered class of small (20-22 nt) noncoding RNAs that control gene expression posttranscriptionally by regulating mRNA translation or stability. 5 The roles of miRs in regulating the hematopoietic system are still poorly understood, although a series of recent studies have provided some perspective on this important issue. 6 There are several miRs, including miR-142, miR-181a, and miR-223, that are prominently expressed in hematopoietic cells. 7,8 Ectopic expression of miR-181a in hematopoietic stem/progenitor cells promotes B-cell differentiation, whereas overexpression of miR-142 and miR-223 leads to an increase in the proportion of T-lineage cells. 7 Some studies have not only delineated a role for miRs in hematopoiesis but also uncovered their molecular mechanisms of action involving regulation of lineage determining transcription factors. For example, the combination of gain-of-function and loss-of-function strategies has defined the requirement of miR-150 in B-cell differentiation by targeting the transcription factor c-Myb. 9 During monocytopoiesis, down-regulation of miRs 17-5p-20a-106a relieves the suppression of AML1, thus facilitating monocytic differentiation and maturation. 10 In addition to the role of specific miRs, the general requirement of miRs in hematopoiesis has been demonstrated, as deletion of Dicer in the thymus results in aberrant T-cell development in the murine system. 11,12 There is expanding literature suggesting that miRs also play an important role in the pathology of hematologic malignancies as tumor suppressor genes or oncogenes. For example, both miR-15a and miR-16 are deleted or down-regulated in the majority of chronic lymphocytic leukemia cases, 13 whereas C57BL6 mice transplanted with murine hematopoietic progenitor cells overexpressing miR-155 developed a myeloproliferative disorder. 14 Given compelling evidence that miRs are essential in the hematopoietic system, we sought to elucidate the potential roles of miRs in early human hematopoietic development. Insights into hematopoietic development have largely relied on findings from gene knockout and transgenic mouse models as well as in other model organisms. Because of the inaccessibility of human embryos,...

show abstract

“…This technique has recently been used in hESCs, first reported by Zhou et al, using a tet-on lentiviral vector system expressing the transcriptional suppression domain [8]. An independent study also indicates that the tet-on transactivator does not impair the self-renewal or pluripotency of hESCs and thus can safely be applied in these cells [7]. Another conditional gene expression system, Cre-ERT2, has also been demonstrated to efficiently control transgene expression in hESCs [6].…”

Section: Introductionmentioning

confidence: 99%

In Vitro- and In Vivo-Induced Transgene Expression in Human Embryonic Stem Cells and Derivatives

et al. 2007

View full text Add to dashboard Cite

The use of human embryonic stem cells (hESCs) as a research and therapeutic tool will be facilitated by conditional gene expression. Here, we report drug-induced transgene expression, both in vitro and in vivo, from a tet-on hESC line with >95% purity. Using green fluorescent protein as an indicator, we demonstrated that the tet-on system allowed a tight control of the gene expression in both undifferentiated hESCs and differentiated cells of the three germ layers. More importantly, after the cells were transplanted into animals, the gene expression remained to be regulated by an orally administered drug. These results provide a technical basis for regulation of gene expression in hESCs and derivatives in vitro and in vivo. STEM CELLS 2008;26:525-533 Disclosure of potential conflicts of interest is found at the end of this article.

show abstract

Pluripotentiality and Conditional Transgene Regulation in Human Embryonic Stem Cells Expressing Insulated Tetracycline-ON Transactivator

Cited by 36 publications

References 23 publications

Conditional Induction of Math1 Specifies Embryonic Stem Cells to Cerebellar Granule Neuron Lineage and Promotes Differentiation into Mature Granule Neurons

Conditional Induction of Math1 Specifies Embryonic Stem Cells to Cerebellar Granule Neuron Lineage and Promotes Differentiation into Mature Granule Neurons

Regulated expression of microRNAs-126/126* inhibits erythropoiesis from human embryonic stem cells

In Vitro- and In Vivo-Induced Transgene Expression in Human Embryonic Stem Cells and Derivatives

Contact Info

Product

Resources

About