Polarized trafficking and copper transport activity of ATP7B: A mutational approach to establish genotype–phenotype correlation in Wilson disease

Abstract

Mutation in ATP7B gene causes Wilson disease (WD) that is characterized by severe hepatic and neurological symptoms. ATP7B localizes at the trans-Golgi Network (TGN) transporting copper to copper-dependent enzymes and traffics in apically targeted vesicles upon intracellular copper elevation. To decode the cellular underpinnings of WD manifestation we investigated copper-responsive polarized trafficking and copper transport activity of 15 WD causing point mutations in ATP7B. Amino-terminal mutations Gly85Val, Leu168Pro, and Gly591Asp displayed TGN and subapical localization whereas, Leu492Ser mislocalized at the basolateral region. The actuator domain mutation Gly875Arg shows retention in the endoplasmic reticulum (ER), Ala874Val and Leu795Phe show partial targeting to TGN and post-Golgi vesicles. The nucleotide-binding domain mutations His1069Gln and Leu1083Phe also display impaired targeting. The C-terminal mutations Leu1373Pro/Arg is arrested at ER but Ser1423Asn shows TGN localization. Transmembrane mutant Arg778Leu resides in ER and TGN while Arg969Gln is exclusively ER localized. Cellular Cu level does not alter the targeting of any of the studied mutations. Mutants that traffic to TGN exhibits biosynthetic function. Finally, we correlated cellular phenotypes with the clinical manifestation of the two most prevalent mutations; the early onset and more aggressive WD caused by Arg778Leu and the milder form of WD caused by mutation His1069Gln.

Regulation of apico-basolateral trafficking polarity of homologous Copper-ATPases ATP7A and ATP7B

“…1B). We have previously shown that Cu levels do not affect the endogenous expression levels of ATP7A and ATP7B, which corroborates findings from other groups (Das et al, 2022;Barnes et al, 2009;Leonhardt et al, 2009).…”

“…No reuse allowed without permission. ATP7A and ATP7B localize at the TGN in basal and depleted copper conditions 57,58 . We asked whether ATP7A and ATP7B colocalize within the TGN domains and whether copper-dependent polarized trafficking of ATP7A and ATP7B is preceded by changes in their localization within the TGN.…”

Copper-independent lysosomal localization of the Wilson disease protein ATP7B

“…Mutations on mEGFP-ATP7B were prepared following Q5 ® Site-Directed Mutagenesis Kit (NEB #E0554) protocol. Preparation of H1069Q mutant is described in Das et al (Das et al, 2022). Primers used for S653Y mutant are forward-5’TGGAAGAAGTATTTCCTGTGC3’ and reverse-5’CTGCTTTATTTCCATCTTG3’.…”

“…More than 400 WD causing mutations are known for the ATP7B protein. Many of them results in defective trafficking of the protein (Das et al, 2022). H1069Q, the most prevalent mutations reported in Caucasian population exhibits compromised copper-induced Golgi exit of the protein (Payne et al, 1998).…”

“…Mutations on mEGFP-ATP7B were prepared following Q5 ® Site-Directed Mutagenesis Kit (NEB #E0554) protocol. Preparation of H1069Q mutant is described in Das et al (Das et al, 2022) For copper treatment, 100µM CuCl2 was used for 2hrs, else mentioned otherwise. For creating copper deprived condition, cells were treated with 100 µM BCS or 25 µM TTM for 2 hrs.…”