Polycistronic mRNAs and internal ribosome entry site elements (IRES) are widely used by white spot syndrome virus (WSSV) structural protein genes

Abstract

The genome of the white spot syndrome virus (WSSV) Taiwan isolate has many structural and non-structural genes that are arranged in clusters. Screening with Northern blots showed that at least four of these clusters produce polycistronic mRNA, and one of these (vp31/vp39b/vp11) was studied in detail. The vp31/vp39b/vp11 cluster produces two transcripts, including a large 3.4-kb polycistronic transcript of all three genes. No monocistronic vp39b mRNA was detected. TNT and in vitro translation assays showed that vp39b translation was independent of vp31 translation, and that ribosomal reinitiation was not a possible mechanism for vp39b. An unusually located IRES (internal ribosome entry site) element was identified in the vp31/vp39b coding region, and this region was able to promote the expression of a downstream firefly luciferase reporter. We show that vp31/vp39b/vp11 is representative of many other WSSV structural/non-structural gene clusters, and argue that these are also likely to produce polycistronic mRNAs and that use an IRES mechanism to regulate their translation.

The DNA Virus White Spot Syndrome Virus Uses an Internal Ribosome Entry Site for Translation of the Highly Expressed Nonstructural Protein ICP35

“…To date, although IRES elements have been quite widely reported in RNA viruses, only a very limited number of IRES elements have been reported in a few DNA viruses, including Kaposi's sarcoma-associated herpesvirus (KSHV) (7)(8)(9), Epstein-Barr virus (EBV) (10), herpes simplex virus (HSV) (11), murine gammaherpesvirus 68 (MHV-68) (12), Marek's disease virus (MDV) (13), and simian vacuolating virus 40 (SV40) (14).White spot syndrome virus (WSSV), a large (ϳ300-kbp), double-stranded DNA (dsDNA) virus in the family Nimaviradae that is the causative pathogen of a serious disease in shrimp (15,16), is another DNA virus that uses IRES translation, and the large number of WSSV polycistronic mRNAs suggests that IRES elements are widely used by this virus to regulate translation during infection (17).…”

“…So far, however, only two IRES elements have been positively identified in WSSV: one is located upstream of wssv480 (vp28) (18) and the other extends across the coding regions of wssv396 (vp31) and wssv395 (vp39b) (17). In the present study, we follow up on an earlier report (19) that a wssv019 riboprobe detected both a large 5.5-kb mRNA encoding wssv023, wssv019 (icp35), and other genes and a small 1.3-kb mRNA encoding only wssv019.…”

“…Schematics for all of the plasmids used in this study can be found in Results. The backbone plasmid used for the dualluciferase assays was constructed as described previously (17). Basically, the firefly luciferase (FL) from plasmid pGL3 (Promega) was inserted into the pRL-null plasmid (Promega) to give the dual-luciferase plasmid T7/ pRL-FL (7), but before transient DNA transfection in Spodoptera frugiperda Sf9 cells, the T7 promoter was replaced by the WSSV ie1 promoter (positions Ϫ94 to ϩ52) (23).…”

“…Basically, the firefly luciferase (FL) from plasmid pGL3 (Promega) was inserted into the pRL-null plasmid (Promega) to give the dual-luciferase plasmid T7/ pRL-FL (7), but before transient DNA transfection in Spodoptera frugiperda Sf9 cells, the T7 promoter was replaced by the WSSV ie1 promoter (positions Ϫ94 to ϩ52) (23). This substitution was achieved by PCR amplification with the primers ie1-promoter-SacI-F and ie1-promoterNheI-R (Table 1) to clone the ie1 promoter into the SacI-NheI sites of T7/pRL-FL to produce the construct ie1/pRL-FL (17). The putative IRES elements in the 5= UTR of icp35 and its antisense sequence (as a negative control) were PCR amplified using KODϩ Taq polymerase (Toyobo) with the primer sets listed in Table 1 to clone each respective element into the reporter construct ie1/pRL-FL to generate the corresponding plasmids.…”

“…To rule out the possibility of ribosomal read-through, a 28-bp stable stem-loop structure with a free energy of Ϫ62 kcal/mol (5=-GCTAGCGG TACGGCAGTGCCGTACGACGAATTCGTCGTACGGCACTGCCGT ACCGCTAGC-3=) (7) was introduced upstream of the Renilla luciferase (RL) ORF using the NheI site, as described previously (17), to generate plasmid ie1/SL-pRL-icp35(Ϫ198/Ϫ1)-FL.…”