Polydorid species (Polychaeta, Spionidae) associated with commercially important mollusk shells from eastern China

Sato-Okoshi, Waka; Okoshi, Kenji; Abe, Haruo; Li, J.-Y.

doi:10.1016/j.aquaculture.2013.05.017

Cited by 23 publications

(4 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nuclear 18S rRNA and 28S rRNA, and mitochondrial 16S rRNA and cytochrome b ( cyt b ) gene analyses were performed on P. uncinata and P. hoplura collected from Japan, Australia and South Africa (Table 1). Genomic DNA was extracted from live or ethanol-preserved tissues and nuclear 18S rRNA gene analysis was performed according to the methods described by Sato-Okoshi & Abe (2012, 2013) and Teramoto et al (2013). For nuclear 28S rRNA, mitochondrial 16S rRNA, and cyt b gene analysis, three primer pairs D1R/D2C (forward: ACCCGCTGAATTTAAGCATA, reverse: CCTTGGTCCGTGTTTCAAGA) (Scholin et al , 1994), 16Sar/16Sbr (forward: CGCCTGTTTATCAAAAACAT, reverse: CCGGTCTGAACTCAGATCACGT) (Palumbi et al , 1991), and cytbPuh10F/cytbPuh382R (forward: AGCAATTCCYTACTTTGGCGA, reverse: AGGAAGTATCATTCAGGTTGAATATG) (this study) were used, respectively.…”

Section: Methodsmentioning

confidence: 99%

And then there was one:Polydora uncinataandPolydora hoplura(Annelida: Spionidae), the problematic polydorid pest species represent a single species

et al. 2016

View full text Add to dashboard Cite

It is necessary to monitor shell-associated polydorid worms owing to the risk that they pose to commercially important molluscs. This requires accurate identification, but is often hampered by morphological similarities among species, insufficient type specimens, and abridged species descriptions. Thus morphological characteristics and molecular sequences of the most harmful polydorid species, Polydora uncinata from Japan and Australia and Polydora hoplura from South Africa were compared to determine whether they represent two morphologically similar, but genetically distinct species, or a single species. A wide range of morphological variation (with respect to size, length of caruncle and pigmentation patterns) was observed in each species and population, and their variations largely overlapped and revealed them to be at the intraspecific level of a single species. This was confirmed by gene sequences of nuclear 18S and 28S rRNA that were completely identical for P. uncinata and P. hoplura. The mitochondrial 16S rRNA and cyt b gene analyses also showed no genetic differences between these two species. The tree topology of the mitochondrial cyt b gene did not reflect geographic differences but instead suggests artificial transportation of the species. We recommend the synonymization of P. uncinata with P. hoplura.

show abstract

Section: Methodsmentioning

confidence: 99%

And then there was one:Polydora uncinataandPolydora hoplura(Annelida: Spionidae), the problematic polydorid pest species represent a single species

et al. 2016

View full text Add to dashboard Cite

show abstract

“…However, the phylogenetic placement of some genera (e.g., Aonides , Carazziella , Microspio , Dispio , Tripolydora , and Pygospiopsis ) has not been clarifi ed, and in most genera the relationships among species have not been studied. This lack of phylogenetic studies is evident for spionids along the Chinese coasts: although there have been records of 17 genera and 69 species of spionids (Institute of Oceanology, Chinese Academy of Sciences and Liu, 2008;Zhou, 2008;Zhou and Li, 2009;Zhou et al, 2010b), only 9 species in 4 genera ( Scolelepis , Polydora , Boccardiella , and Pseudopolydora ) have been examined with molecular tools (Zhou et al, 2010a;Sato-Okoshi et al, 2013;Ye et al, 2015Ye et al, , 2017Ye et al, , 2019a.…”

Section: Introductionmentioning

confidence: 99%

Morphological analysis of Rhynchospio aff. asiatica (Annelida: Spionidae) and comments on the phylogeny and reproduction of the family Spionidae

Qiu

et al. 2022

J. Ocean. Limnol.

View full text Add to dashboard Cite

The genus Rhynchospio has fronto-lateral horns on prostomium, paired branchiae from chaetiger 2 to near the posterior end, capillary notochaetae only, and more than two pairs of pygidial cirri. Rhynchospio species are common in coastal soft bottom communities; nevertheless, many recorded Rhynchospio specimens around the world are currently undescribed. Here we described a Rhynchospio species based on specimens collected from Qingdao, China. Comparison with the reported DNA sequences of four gene markers (16S rRNA, 18S rRNA, 28S rRNA, and Histone H3) and brief morphological description of specimens collected from Jinhae Bay, South Korea, previously reported as Rhynchospio aff . asiatica , indicated that they are conspecifi c. Morphologically, specimens of R . aff . asiatica from Qingdao are characterized by having neuropodial hooded hooks from chaetigers 14-17 (vs. 10-23 in R . asiatica ) to near pygidial chaetigers, sperm from chaetiger 11 to 14 (vs. from chaetiger 11 to 21-22 in R . asiatica ), oocytes from chaetigers 16-17 to 26-39 (vs. from 22-24 in R . asiatica ), and 4-6 (vs. up to 6 in R . asiatica ) pygidial cirri. Genetically, Rhynchospio aff . asiatica is most closely related to R . arenincola Hartman, 1936 from California, USA with the interspecifi c distances of 20.02% (16S rRNA), 4.50% (18S rRNA), 8.44% (28S rRNA), 2.74% (Histone H3), and 6.10% (concatenated sequences). Water fl ow across the dorsum created by ciliary beating of the branchiae and nototrochs, observed on live specimens, may help transport gametes from reproductive segments in anterior and middle parts to the posterior brooding segments. Phylogenetic trees based on concatenated sequences of four gene markers of 54 spioniform species in 25 genera revealed two clades, covering the two subfamilies Spioninae and Nerininae respectively. Two families (i.e., Poecilochaetidae and Trochochaetidae) in the order Spionida were clustered within Spionidae, supporting a morphology-based proposal that these families bearing a pair of prehensile, grooved palps should be grouped within a more broadly defi ned family Spionidae. Mapping morphological and reproductive characteristics to the phylogenetic trees indicated that the ancestor of spionids might lack branchiae, broadcast spawn thick-envelop oocytes and ect-aquasperm, and produce planktotrophic larvae.

show abstract

“…It causes distress to the host, reduces their growth rates, makes them susceptible to parasites or diseases, and their presence (so-called ‘mud blisters’) lowers the market value of bivalves 20 . In this way, P. websteri causes considerable economic losses in commercial marine mollusk aquaculture globally 21 , 22 . The congeneric and morphologically similar Polydora brevipalpa Zachs, 1933 is a relatively poorly studied species with an apparently broad range throughout the North Pacific 20 .…”

Section: Introductionmentioning

confidence: 99%

“…The congeneric and morphologically similar Polydora brevipalpa Zachs, 1933 is a relatively poorly studied species with an apparently broad range throughout the North Pacific 20 . It primarily infests scallops (Pectinidae), and there is some evidence that it can also cause economic losses 22 , 23 . Therefore, apart from contributing to the understanding of evolutionary dynamics of the mitochondrial genome in Sedentaria, the sequencing of these two mitogenomes will also contribute useful data for future biogeographic and evolutionary studies of these two economically important polychaete species.…”

Section: Introductionmentioning

confidence: 99%

Mitochondrial genomes of two Polydora (Spionidae) species provide further evidence that mitochondrial architecture in the Sedentaria (Annelida) is not conserved

Tuo

et al. 2021

Sci Rep

View full text Add to dashboard Cite

Contrary to the early evidence, which indicated that the mitochondrial architecture in one of the two major annelida clades, Sedentaria, is relatively conserved, a handful of relatively recent studies found evidence that some species exhibit elevated rates of mitochondrial architecture evolution. We sequenced complete mitogenomes belonging to two congeneric shell-boring Spionidae species that cause considerable economic losses in the commercial marine mollusk aquaculture: Polydora brevipalpa and Polydora websteri. The two mitogenomes exhibited very similar architecture. In comparison to other sedentarians, they exhibited some standard features, including all genes encoded on the same strand, uncommon but not unique duplicated trnM gene, as well as a number of unique features. Their comparatively large size (17,673 bp) can be attributed to four non-coding regions larger than 500 bp. We identified an unusually large (putative) overlap of 14 bases between nad2 and cox1 genes in both species. Importantly, the two species exhibited completely rearranged gene orders in comparison to all other available mitogenomes. Along with Serpulidae and Sabellidae, Polydora is the third identified sedentarian lineage that exhibits disproportionally elevated rates of mitogenomic architecture rearrangements. Selection analyses indicate that these three lineages also exhibited relaxed purifying selection pressures.

show abstract

Polydorid species (Polychaeta, Spionidae) associated with commercially important mollusk shells from eastern China

Cited by 23 publications

References 23 publications

And then there was one:Polydora uncinataandPolydora hoplura(Annelida: Spionidae), the problematic polydorid pest species represent a single species

And then there was one:Polydora uncinataandPolydora hoplura(Annelida: Spionidae), the problematic polydorid pest species represent a single species

Morphological analysis of Rhynchospio aff. asiatica (Annelida: Spionidae) and comments on the phylogeny and reproduction of the family Spionidae

Mitochondrial genomes of two Polydora (Spionidae) species provide further evidence that mitochondrial architecture in the Sedentaria (Annelida) is not conserved

Contact Info

Product

Resources

About