Population size, distribution, threats and conservation status of two endangered bat species Craseonycteris thonglongyai and Hipposideros turpis

Abstract

The population size, distribution, threats and conservation status of 2 bat species included as 'endangered' in the IUCN Red List were assessed in Thailand and Myanmar. Craseonycteris thonglongyai Hill, 1974 and Hipposideros turpis Bangs, 1901 are both rare and poorly known cave-dwelling species, which have restricted distributions and small population sizes. Surveys of the 2 species were conducted in a large number of locations including previously reported sites and potential new locations. Colony size was counted at currently known localities, and population size was estimated. The known distribution and population are larger than in previous estimates, but both species still remain threatened by roost disturbance and the destruction of foraging habitat. Clarification of the taxonomic status of allopatric populations within each species is urgently required.

Genome analysis reveals insights into physiology and longevity of the Brandt’s bat Myotis brandtii

“…In contrast, a larger body size may be advantageous for bat species, some of which do not echolocate, that feed on bigger, slow-moving insects or fish or fruits. Echolocating insectivorous bats smaller than the Brandt’s bat, such as the distantly related 2 g bumblebee bat Craseonycteris thonglongyai in the suborder Yinpterochiroptera54, but with unknown maximum lifespans, exist. Although it is appreciated that other genes have been altered during the ~82 million years of bat evolution, we suggest that the changes observed in GHR and IGF1R contribute to the longevity and dwarfism-like phenotype of the Brandt’s bat.…”

Systematics of the Hipposideros turpis complex and a description of a new subspecies from Vietnam

“…2; Table 2). The nose leaf characteristics of H. alongensis clearly resemble those of H. larvatus and differ from those of H. turpis (Puechmaille et al. 2009; Figs 1 and 4).…”

“…in press). For some H. armiger and H. pendleburyi samples, a larger fragment including the entire Cytochrome b and partial d ‐loop (1643bp) was amplified using the primers mtDNA‐R3‐F (see earlier) and mtDNA‐F2‐R (5′‐ATGGCCCTGAAGAAAGAACCAGATG‐3′; Puechmaille et al. in press) and the biglycan (BGN) nuclear intron was amplified using primers BGN‐F (5′‐CTCCAAGAACCACCTGGTG‐3′) and BGN‐R (5′‐TTCAAAGCCACTGTTCTCCAG‐3′; Lyons et al.…”

“…Some authors have recently questioned the rank of taxa recognised within H. turpis (Csorba et al. 2008, Puechmaille et al. 2009).…”

“…2002, 2009). In Thailand, H. t. pendleburyi has also received attention through an assessment of its population size, distribution, threats and conservation status (Puechmaille et al. 2009).…”