Postfertilization Deadenylation of mRNAs in Xenopus laevis Embryos Is Sufficient To Cause Their Degradation at the Blastula Stage

Abstract

Although the maternal Xenopus laevis Eg mRNAs are deadenylated after fertilization, they are not immediately degraded and they persist in the embryos as poly(A) ؊ transcripts. The degradation of these RNAs is not detected until the blastula stage of development (6 to 7 h postfertilization). To understand the basis for this delay between deadenylation and degradation, it is necessary to identify the cis-acting element(s) required to trigger degradation in blastula stage embryos. To this end, several chimeric RNAs containing different portions of the 3 untranslated region of Eg2 mRNA were injected into two-cell X. laevis embryos. We observed that only the RNAs that contained the cis-acting elements that confer rapid deadenylation were subsequently degraded at the blastula stage. This suggested that deadenylation may be sufficient to trigger degradation. By injecting chimeric RNAs devoid of Eg sequence information, we further showed that only deadenylated RNAs were degraded in X. laevis embryos. Last, introduction of a functional cytoplasmic polyadenylation element into a poly(A) ؊ RNA, thereby causing its polyadenylation after injection into embryos, protected the RNA from degradation. Hence, in X. laevis embryos, the postfertilization deadenylation of maternal Eg mRNAs is sufficient to cause the degradation of an mRNA, which, however, only becomes apparent at the blastula stage. Possible causes for this delay between deadenylation and degradation are discussed in the light of these results.In many species, transcription is effectively silent during the period encompassing the meiotic maturation and the early development that immediately follows fertilization. From this it follows that the regulation of gene expression at the posttranscriptional level (localization, translation and stability) probably plays a critical role in the control of early development. In Drosophila melanogaster the importance of controlling the localization and the translation of specific maternal mRNAs has been clearly established (25). Furthermore, changes in the stability of specific maternal mRNAs are a way of removing transcripts that encode proteins nefarious for embryonic development, as suggested for the Cdc25 gene product in Drosophila (7).In Xenopus laevis, members of the family of maternal mRNAs, denoted Eg mRNAs, were originally identified as mRNAs that were deadenylated and released from polysomes after fertilization (17,18). Two of these mRNAs encode proteins implicated in cell cycle control: Eg1-cdk2 (16) and Eg5, a kinesin-related protein (12). Sequence analysis suggests that the Eg2 mRNA encodes a Ser-Thr protein kinase (20a). The maternal Eg mRNAs, in addition to their postfertilization deadenylation, also undergo characteristic changes in their stability during early development. These mRNAs appear to accumulate as poly(A) Ϫ transcripts before being degraded (17). The decay of these mRNAs becomes apparent during the midblastula transition (MBT) (6).In somatic cells, mRNA degradation can be triggered by several different ...

c-Jun ARE Targets mRNA Deadenylation by an EDEN-BP (Embryo Deadenylation Element-binding Protein)-dependent Pathway

“…A completely deadenylated form of the GbORF-jun transcript could be detected as early as 1 h after injection (lane 6), and the transcript was predominantly deadenylated 3 h after injection (lane 8). In contrast, and as previously shown (12), no completely deadenylated form of the reporter RNA alone (GbORF) could be detected, even 3 h after injection (lane 4). The deadenylation pattern of the GbORF transcript is evocative of default deadenylation, a slow activity for which the only sequence specificity is an absence of a CPE, which is stimulated during oocyte maturation and persists after fertilization (23)(24)(25).…”

“…Cloning Procedures-c-Jun ARE (4, 21) was amplified by RT-PCR from HeLa cell RNA with the following primers: sense, GCTCTAGAT-CTGGCCTGCTTTCGTTAACTGTGTATG; antisense, GTAATGGATC-CTCTTTTTATTAGGAGCAGATACGCTAGCTTTATTAAATCTCTTAT-TTACAAACAACACTGGGC and was cloned into the BamHI and XbaI sites of the pGbORF vector (12), giving the pGbORF-jun plasmid. Annealed primers sense, CTAGAAGCTTAGATCTATTTATTTATTTA-TTTATTTATTTATTTATTTACTAGTGGTACC; antisense, CTAGGTA-CCACTAGTAAATAAATAAATAAATAAATAAATAAATAAATAGATC-TAAGCTT were cloned in the XbaI and NheI sites of the same vector to give the pGBORF-AUUUA plasmid.…”

“…First, in Xenopus embryos, mRNA deadenylation and degradation, though functionally coupled, are temporally uncoupled. Deadenylated RNAs are as stable as their polyadenylated counterparts until the blastula stage, several hours after fertilization (12,13). This allows these two phenomena to be analyzed separately.…”

The mechanism and regulation of deadenylation: Identification and characterization of Xenopus PARN

“…Purification of Xenopus PARN+ A: A total of 2+5 mg total protein from S100, DEAE, and heparin active fractions and 50 units xPARN activity from the active poly(A) fraction were resolved by SDS-PAGE (15%) and detected by silver staining+ B: Fractionation of the active poly(A) material by MonoQ chromatography+ Proteins were resolved by SDS-PAGE (15%) and detected by silver staining+ The graph below indicates the amount of xPARN activity in corresponding fractions+ suggesting that p62 is derived from the p74 species by proteolytic cleavage+ This appears to be a specific cleavage, as the truncated p62 protein is not further degraded+ In addition, this proteolysis appears to be insensitive to PMSF, which was used throughout the purification+ Interestingly, the putative modification of p74 is also lost in the absence of protease inhibitors+ These data indicate that p74 is the precursor of p62 and, because the activity of p74 hPARN is stimulated by the presence of a 59 cap, we believe that p74 xPARN is responsible for cap-dependent activity observed in mature Xenopus oocytes in vivo+ Previous analysis of xPARN subcellular localization showed that p62 is cytoplasmic whereas p74 is nuclear (Korner et al+, 1998)+ Analyses of the predicted protein sequence of xPARN using the PORT II Prediction algorithm reveals the presence of a single putative nuclear localization signal (NLS) located in the C-terminal portion (amino acids 522-539)+ Thus, it is likely that the proteolysis is occurring in the C-terminal domain and that this region is required for nuclear localization+ Figure 2C shows a developmental western blot probed with anti-hPARN and FRGY2 antibodies as described above+ This blot shows that p74 xPARN protein is readily detectable in later embryonic stages with an apparent peak of expression during gastrulation+ These data suggest that xPARN activity persists well after fertilization and therefore may also participate in fertilization-specific deadenylation (Bouvet et al+, 1994;Sheets et al+, 1994;Stebbins-Boaz & Richter, 1994;Legagneux et al+, 1995) as well as post-mid-blastula transition mRNA destabilization (Audic et al+, 1997;Voeltz & Steitz, 1998)+…”

Metazoan oocyte and early embryo development program: a progression through translation regulatory cascades

“…Interestingly, there is no decay of Xenopus messages following deadenylation through oocyte maturation or in the early stages of embryo development (until the mid-blastula transition), suggesting a reversible regulatory process that can shift mRNAs between repressed and translationally active states (Audic et al 1997;Voeltz and Steitz 1998). Tethering of poly(A) polymerase leads to premature activation of translation of such messages (Dickson et al 2001;Rouhana et al 2005).…”