Potential of Inactivated Bifidobacterium Strain in Attenuating Benzo(A)Pyrene Exposure-Induced Damage in Colon Epithelial Cells In Vitro

Xu, Mengfan; Fu, Lili; Zhang, Junwen; Wang, Tao; Fan, Junfeng; Zhu, Baoqing; Dziugan, Piotr; Zhang, Bolin

doi:10.3390/toxics8010012

Cited by 9 publications

(5 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previous studies have shown that L. rhamnosus GG and its metabolites can inhibit cytokine-induced apoptosis of human or mouse intestinal epithelial cells by downregulating the p38/MAPK activation and upregulating the PI3K/AKT cascade [ 31 ]. Bifidobacterium animalis subsp lactis BI-04 can delay benzo [a] pyrene (BAP)-induced apoptosis of colon epithelial cells by upregulating the PI3K/AKT signaling pathway and downregulating p53 gene expression [ 32 ]. In this study, H22 hepatoma cells treated with B. coagulans MZY531 showed a concentration-dependent reduction in the expression of p-PI3K, p-AKT and p-mTOR compared to the control group.…”

Section: Discussionmentioning

confidence: 99%

Anticancer potential of Bacillus coagulans MZY531 on mouse H22 hepatocellular carcinoma cells via anti-proliferation and apoptosis induction

Zhao,

Yang,

Zhou

et al. 2023

BMC Complement Med Ther

View full text Add to dashboard Cite

Bacillus coagulans have recently revealed its anticancer effects, but few investigations are available on their effects on liver cancer proliferation, and the precise mechanism to mark its impact on apoptosis-related signaling pathways has yet to be elucidated. The aim of this study was to evaluate the anti-proliferative effect of B. coagulans MZY531 and apoptosis induction in the mouse H22 hepatocellular carcinoma cell line. The anti-proliferative activity of B. coagulans MZY531 was evaluated by Cell Counting Kit-8 (CCK-8) assay, and cell apoptosis was revealed with Terminal Deoxynucleotidyl Transferase (TDT)-mediated dUTP Nick-End Labeling (TUNEL) staining and flow cytometric analysis. The expressions of apoptosis-related protein were determined by western blot analysis. The CCK-8 assay revealed that B. coagulans MZY531 inhibited the H22 cells proliferation in a concentration-dependent manner. TUNEL staining revealed an increased apoptosis rate in H22 cells following intervention with B. coagulans MZY531. Furthermore, flow cytometric analysis showed that B. coagulans MZY531 treatment (MOI = 50 and 100) significantly alleviated the H22 cells apoptosis compared with the control group. Western blot analysis found B. coagulans MZY531 significantly decreased level of phospho-PI3K (p-PI3K), phospho-AKT (p-AKT), and phospho-mTOR (p-mTOR) compared with the control group. Furthermore, H22 cells treatment with B. coagulans MZY531 enhanced the expression of caspase-3 and Bax and jeopardized the expression of Bcl-2. Taken together, apoptosis induction and cell proliferation inhibition via PI3K/AKT/mTOR and Bax/Bcl-2/Caspase-3 pathway are promising evidence to support B. coagulans MZY531 as a potential therapeutic agent for cancer.

show abstract

Section: Discussionmentioning

confidence: 99%

Anticancer potential of Bacillus coagulans MZY531 on mouse H22 hepatocellular carcinoma cells via anti-proliferation and apoptosis induction

Zhao,

Yang,

Zhou

et al. 2023

BMC Complement Med Ther

View full text Add to dashboard Cite

show abstract

“…[ 14 ] Inactivated Bifidobacterium detoxified BaP and mitigated the damage it caused to colonic epithelial cells in vitro. [ 15 ] However, BaP adsorption and removal by Lactobacillus in vivo is unclear. Hence, the present study established a model wherein subchronic CICC 23121 infection was induced in mice for 28 d and its efficacy at alleviating oral BaP toxicity was evaluated.…”

Section: Discussionmentioning

confidence: 99%

“…The mRNA expression level of CYP1A1 was determined by real‐time fluorescence qRT‐PCR using β‐actin as an internal reference gene. [ 15 ] RNA was extracted with a UNIQ‐10‐column TRIzol total RNA extraction kit (Sangon; Beijing, China). The sequences of the upstream and downstream CYP1A1 primers were 5’‐TGCCCTTCATTGGTCACATG‐3’ and 5’‐CACGTCCCCATACTGCTGACT‐3’, respectively.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Detoxification of Oral Exposure to Benzo(a)pyrene by Lactobacillus plantarum CICC 23121 in Mice

Liu

et al. 2021

Molecular Nutrition Food Res

Self Cite

View full text Add to dashboard Cite

This study's previous work showed that the carcinogen and mutagen benzo(a)pyrene (BaP) can be adsorbed by Lactobacillus cells in vitro. However, in vivo BaP detoxification by lactic acid bacteria has not yet been investigated. The present study evaluates the effects of orally administered Lactobacillus plantarum CICC 23121 in BaP‐treated mice. Oral administration of 50 mg kg−1 BaP perturbed the intestinal microflora, caused Proteobacteria to predominate, and severely damaged DNA. However, oral administration of 5 × 1010 CFU mL−1 CICC 23121 in BaP‐treated mice enhances fecal BaP excretion from 181.70 ± 1.04 µg/(g∙h) to 271.47 ± 11.71 µg/(g∙h) after 6 h. Fecal BaP excretion reaches up to 280.66 ± 22.97 µg/(g∙h) after the first 4 days of orally administered CICC 23121 and decreased to 94.31 ± 2.64 µg/(g∙h) by day 11. Intestinal microbiota are restored and Firmicutes predominates. CICC 23121 alleviates BaP‐induced DNA damage and reduces tail length from 56.37 ± 5.31 to 39.69 ± 4.27 µm. Therefore, oral CICC23121 consumption is a promising strategy for reducing BaP toxicity in mice. To the best of our knowledge, this report is the first report to demonstrate in vivo that Lactobacillus cells can detoxify BaP.

show abstract

“…lactis BI-04 strain can retard Benzo(a)pyrene (BaP)-induced apoptosis of the colonic epithelial cells by up-regulating the PI3K/Akt signaling pathway and down-regulating p53 gene expression. 56 In light of these findings, some researchers have hypothesized that the induction of apoptosis in the SW480 cell line could occur in the presence of heat-killed preparations of Saccharomyces cerevisiae through enhanced expression of BAX, cleaved caspase-3, and cleaved caspase-9 and reduced expression of p -Akt1, Bcl-XL, pro-caspase 3 and 9, which are involved in the Akt/NF-κB signaling pathway. 36 Therefore, by targeting apoptosis and survival-related signaling pathways these probiotics may offer important therapeutic options for cancer management.…”

Section: Probiotics Autophagy and Apoptosismentioning

confidence: 99%

Modulation of the PI3K/Akt/mTOR signaling pathway by probiotics as a fruitful target for orchestrating the immune response

et al. 2021

View full text Add to dashboard Cite

The mammalian target of rapamycin (mTOR) and the phosphatidylinositol-3-kinase (PI3K)/protein kinase B or Akt (PKB/Akt) signaling pathways are considered as two but somewhat interconnected significant immune pathways which play complex roles in a variety of physiological processes as well as pathological conditions. Aberrant activation of PI3K/Akt/mTOR signaling pathways has been reported to be associated in a wide variety of human diseases. Over the past few years, growing evidence in in vitro and in vivo models suggest that this sophisticated and subtle cascade mediates the orchestration of the immune response in health and disease through exposure to probiotics. An expanding body of literature has highlighted the contribution of probiotics and PI3K/Akt/mTOR signaling pathways in gastrointestinal disorders, metabolic syndrome, skin diseases, allergy, salmonella infection, and aging. However, longitudinal human studies are possibly required to verify more conclusively whether the investigational tools used to understand the regulation of these pathways might provide effective approaches in the prevention and treatment of various disorders. In this Review, we summarize the experimental evidence from recent peer-reviewed studies and provide a brief overview of the causal relationship between the effects of probiotics and their metabolites on the components of PI3K/Akt/mTOR signaling pathways and human disease.

show abstract

Potential of Inactivated Bifidobacterium Strain in Attenuating Benzo(A)Pyrene Exposure-Induced Damage in Colon Epithelial Cells In Vitro

Cited by 9 publications

References 38 publications

Anticancer potential of Bacillus coagulans MZY531 on mouse H22 hepatocellular carcinoma cells via anti-proliferation and apoptosis induction

Anticancer potential of Bacillus coagulans MZY531 on mouse H22 hepatocellular carcinoma cells via anti-proliferation and apoptosis induction

Detoxification of Oral Exposure to Benzo(a)pyrene by Lactobacillus plantarum CICC 23121 in Mice

Modulation of the PI3K/Akt/mTOR signaling pathway by probiotics as a fruitful target for orchestrating the immune response

Contact Info

Product

Resources

About