Precise annotation of tick mitochondrial genomes reveals multiple copy number variation of short tandem repeats and one transposon-like element

Abstract

<jats:title>Abstract</jats:title> <jats:p><jats:bold>Background</jats:bold>: In the present study, we used long-PCR amplification coupled with Next-Generation Sequencing (NGS) to obtain complete mitochondrial (mt) genomes of individual ticks and unprecedently performed precise annotation of these mt genomes. We aimed to: (1) to develop a simple, cost-effective and accurate method for the study of extremely high AT-content mt genomes within an individual animal (e.g. <jats:italic>Dermacentor silvarum</jats:italic>) containing miniscule DNA; (2) to provide a high-quality reference genome for <jats:italic>D. silvarum</jats:italic> with precise annotation and also for future studies of other tick mt genomes; and (3) to detect and analyze mt DNA variation within an individual tick.<jats:bold>Results</jats:bold>: These annotations were confirmed by the PacBio full-length transcriptome data to cover both entire strands of the mitochondrial genomes without any gaps or overlaps. Moreover, two new and important findings were reported for the first time, contributing fundamental knowledge to mt biology. The first was the discovery of a transposon-like element that may eventually reveal much about mechanisms of gene rearrangements in mt genomes. Another finding was that Copy Number Variation (CNV) of Short Tandem Repeats (STRs) account for mitochondrial sequence diversity (heterogeneity) within an individual tick, insect, mouse or human, whereas SNPs were not detected. The CNV of STRs in the protein-coding genes resulted in frameshift mutations in the proteins, which can cause deleterious effects. Mitochondria containing these deleterious STR mutations accumulate in cells and can produce deleterious proteins. <jats:bold>Conclusions</jats:bold>: We proposed that the accumulation of CNV of STRs in mitochondria may cause aging or diseases. Future tests of the CNV of STRs hypothesis help to ultimately reveal the genetic basis of mitochondrial DNA variation and its consequences (e.g., aging and diseases) in animals. Our study will lead to the reconsideration of the importance of STRs and a unified study of CNV of STRs with longer and shorter repeat units (particularly polynucleotides) in both nuclear and mt genomes.</jats:p>

Precise annotation of Drosophila mitochondrial genomes leads to insights into AT-rich regions

“…Although the intergenic regions in Drosophila mt genomes were cleaved between neighboring tRNAs to form small RNAs (sRNAs), these are unlikely to have biological functions, in our view. The longest intergenic sequence we detected is a 28-nt region (ATATACATATACCTCTAATAATTAAATA) between tRNA Arg and 192 tRNA Asn in B. oleae mt genome, thereby confirming that apart from a novel 31-nt ncRNA, the intergenic regions between mt tRNA genes in insects are longer than those in mammals [5]. One of two important findings in the present study is that two antisense tRNAs (tRNA Thr AS and tRNA Pro AS) in the D. melanogaster mt genome (RefSeq: NC_024511.2) have CCAs at their 3ʹ ends (Figure 1B), which differs from other antisense tRNAs that are characterized by polyA 3ʹ terminal sequences.…”

“…A comparison of the new annotations of all Drosophila and B. oleae mt genomes 178 enabled us to determine the start codons of all mRNA genes. Notable in this respect are the CCG, ATC, and GTG start codons of COI, ATP8/6 and ND5, respectively, in 180 D. simulans as these are seldom used as start codons in insect mt genomes and were 181 not identified in previous precise annotations of the Erthesina fullo [3] and tick [5] mt genomes. In this regard, we incorrectly reported the start codon of COI in the D. 183 silvarum mt genome (GenBank: MN347015) as ATA in our previous study [5], which 184 needs to be corrected to CCG.…”

“…Notable in this respect are the CCG, ATC, and GTG start codons of COI, ATP8/6 and ND5, respectively, in 180 D. simulans as these are seldom used as start codons in insect mt genomes and were 181 not identified in previous precise annotations of the Erthesina fullo [3] and tick [5] mt genomes. In this regard, we incorrectly reported the start codon of COI in the D. 183 silvarum mt genome (GenBank: MN347015) as ATA in our previous study [5], which 184 needs to be corrected to CCG. The new annotations reveal that the ORFs of mRNAs 185 in Drosophila and B. oleae mt genomes starts at their first positions with the 186 exception of COII, while the ORFs of COII start at their 5 th or 6 th positions, as there are several nucleotide residues (AATAA in D. melanogaster) prior to the start codon of ATG.…”

Full-length genome sequence of segmented RNA virus from ticks was obtained using small RNA sequencing data

“…Amblyomma testudinarium, Dermacentor nuttalli, D. niveus and D. silvarum ticks were collected for our previous studies [ 8 , 18 ]. The sRNA-seq data from these ticks were generated and deposited in the NCBI SRA database under the accession numbers SRP084097 and SRP178347 (Table 1 ).…”

Full-length chloroplast genome of Dongxiang wild rice reveals single-copy region switching in cpDNAs

“…Group Genes Self-replication$ Large subunit of ribosomal proteins rpl2*, rpl14, rpl16, rpl20, rpl23, rpl32, rp Small subunit of ribosomal proteins (11) rps2, rps3, rps4, rps7, rps8, rps11, rps12 DNA-dependent RNA polymerase (4) rpoA, rpoB, rpoC1, rpoC2 Ribosomal RNA genes (4) rRNA 16S, 23S, 4.5S, 5S Transfer RNA genes (30) 30 tRNA genes (6 contain an intron) Genes for photosynthesis$ Subunits of NADH-dehydrogenase (11) ndhA*, ndhB*, ndhC, ndhD, ndhE, ndhF, Subunits of photosystem I (5) psaA, psaB, psaC, psaI, psaJ Subunits of photosystem II (15) psbA, psbB, psbC, psbD, psbE, psbF, psbH, Subunits of cytochrome b/f complex (6) petA, petB*, petD*, petG, petL, petN $76 protein-coding genes are present in rice and Onobrychis. The number in parentheses after the group name is the gene number of this group.…”