Prenatal monitoring in a family at high risk for ornithine transcarbamylase (OTC) deficiency: A new mutation of an A-to-C transversion in position +4 of intron 1 of the OTC gene that is likely to abolish enzyme activity

Abstract

DNA analysis of a male propositus with ornithine transcarbamylase (OTC) deficiency documented an A‐to‐C substitution in position +4 of intron 1. No other abnormalities were observed in the OTC gene, or at 563 bp upstream of the 5′ site, which included a promoter region, or at 383 bp downstream of the termination codon, which included a polyadenylation signal sequence. This mutation produces an RsaI site in the sequence, which was used for prenatal monitoring in the fourth and fifth pregnancies. DNA from amniotic cells in the former case were positive for RsaI digestion and the SRY gene (sex determinant region Y), indicating hemizygosity for the mutant allele. OTC activity was not measurable, and mRNA of the OTC gene was not detected by Northern blotting in the affected fetal liver. RT‐PCR (reverse transcription‐PCR) demonstrated only the wild‐type allele. Thus, the mutation interferes with RNA processing, and an extremely low amount of normally spliced mRNA for the OTC gene seems to have caused the disease in our patient. The fetus of the fifth pregnancy was a normal male, as confirmed postnatally. © 1996 Wiley‐Liss, Inc.

Augmentation of urea‐synthetic capacity by inhibition of nitric oxide synthesis in butyrate‐induced differentiated human hepatocytes

“…Complementary DNA was synthesized using 1 μg RNA and random hexamer primers. The PCR amplification of the complementary DNA was conducted in a reaction mixture containing 20 pmol of each primer set (iNOS [7], 5′‐CGGTGCTGTATTTCCTTACGAGGCGAAGAAGG‐3′ and 5′‐GGTGCTGCTTGTTAGGAGGTCAAGTAAAGGGC‐3′; ornithine transcarbamylase (OTC) [8], 5′‐GAGTTTTCAAGGGCATAGAATCGTC‐3′ and 5′‐CAGATCTGCTGATAGCCAT‐3′; argininosuccinate synthase (ASS) [9], 5′‐CACAGCCCCGAGTGTGAATTTGTCC‐3′ and 5′‐AGTGACCTTGCTCTGGAGACGATGA‐3′; hepatocyte nuclear factor‐4 (HNF‐4) [10], 5′‐CTGCTCGGAGCCACAAAGAGATCCATG‐3′ and 5′‐ATCATCTGCCACGTGATGCTCTGCA‐3′; CCAAT/enhancer binding protein (C/EBP)‐β [11], 5′‐GCGCGAGCGCAACAACATC‐3′ and 5′‐TGCTTGAACAAGTTCCGCAG‐3′), 200 μM deoxynucleoside triphosphates and 2 mM MgCl 2 in a DNA thermal cycler (Perkin Elmer, Norwalk, CT, USA). Following 2% agarose gel electrophoresis, ethidium bromide staining was performed to detect the PCR products.…”