Presence of neuroglobin in cultured astrocytes

Chen, Xiao Qian; Qin, Lu; Zhang, Chenggang; Yang, Liang; Gao, Zhen; Liu, Shuang; Lau, Lok Ting; Fung, Yin-Wan Wendy; Greenberg, David A.; Yu, Albert Cheung-Hoi

doi:10.1002/glia.20147

Cited by 49 publications

(55 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Three Ngb-siRNA expression vectors were constructed. The Ngb-siRNA plasmids were cotransfected with p-Ngb-EGFP-N1 plasmids [18] into N2a cells to verify their inhibitory efficiency. The Ngb-siRNA plasmid targeting the gtgatgctagtgattgatttca sequence within the Ngb cDNA inhibited the expression of the Ngb-GFP fusion protein (green under the fluorescent microscope) most effectively (Figure 1A).…”

Section: Resultsmentioning

confidence: 99%

“…Cell viability was significantly decreased in N2a/ Ngb-siRNA cells compared with N2a/vec cells following 150 and 300 µmol/L treatments with H 2 O 2 ( Figure 2A). We then counted the apoptotic cells, which possessed shrunken and condensed nuclei visible with Hoechst staining, as previously reported [18] . After treatment with 150 µmol/L of H 2 O 2 for 12 h, apoptotic nuclei increased in N2a/Ngb-siRNA cells (50.8%) (indicated by arrow head, Figure 2B) compared with N2a/vec cells (20.2%).…”

Section: Resultsmentioning

confidence: 99%

“…The efficiency of Ngb-siRNA plasmids was confirmed by cotransfecting Ngb-siRNA and p-Ngb-EGFP plasmids [18] at a ratio of 4:1 into N2a cells using LipofectAMINE TM 2000 reagent (Invitrogen Life Technology, USA). All constructs were confirmed by DNA sequencing.…”

Section: Methodsmentioning

confidence: 99%

“…Another proposed function of Ngb is the protection of neuronal cells from various pathological insults. Overexpression of Ngb prevents cell death from hypoxia, ischemia, NO, amyloid beta, and H 2 O 2 insults [11,[18][19][20] . However, the administration of penetrating Ngb directly to SH-SY5Y cells does not confer protection from oxygen and glucose deprivation [21] .…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Silencing neuroglobin enhances neuronal vulnerability to oxidative injury by down-regulating 14-3-3γ

Zhou

Lai

et al. 2009

Acta Pharmacol Sin

View full text Add to dashboard Cite

Aim: To explore the protective role and mechanism of endogenous neuroglobin (Ngb) in neuronal cells under oxidative stress. Methods: A stable N2a neuroblastoma cell line expressing the Ngb-siRNA plasmid (N2a/Ngb-siRNA) was established by neomycin screening. Reverse transcription (RT)-PCR and Western blot analysis were used to detect Ngb gene and protein levels. Hydrogen peroxide was used to induce oxidative stress in N2a cells. Cytotoxicity and cell viability were measured by lactate dehydrogenase (LDH) and WST-8 assays. Hoechst staining demonstrated that the quantity of apoptotic cells among N2a/Ngb-siRNA cells following hydrogen peroxide treatment significantly increased compared with controls. In N2a/Ngb-siRNA cells, the expression level of activated caspase-3 significantly increased, whereas the expression of 14-3-3γ decreased compared with that of N2a/vec cells. Transfection of 14-3-3γ plasmids significantly enhanced the viability of N2a/Ngb-siRNA cells following hydrogen peroxide treatment compared with vector controls. Conclusion: Ngb contributes to neuronal defensive machinery against oxidative injuries by regulating 14-3-3γ expression.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Silencing neuroglobin enhances neuronal vulnerability to oxidative injury by down-regulating 14-3-3γ

Zhou

Lai

et al. 2009

Acta Pharmacol Sin

View full text Add to dashboard Cite

show abstract

“…Neuroglobin (Ngb), a newly discovered intracellular respiratory globin with a hexa-coordinated heme (Burmester et al, 2000;Trent et al, 2001), plays an important role in protecting brain cells from ischemic (Sun et al, 2001;Chen et al, 2005b) or oxidative stress (Ye et al, 2009;Antao et al, 2010). Because Ngb shows a higher binding affinity to oxygen and nitric oxide (NO), it is hypothesized that the Ngb may function as the oxygen carrier, NO/ROS scavenger, or oxygen/ ROS sensor (Trent et al, 2001;Herold et al, 2004;Brunori et al, 2005;Burmester and Hankeln, 2009).…”

Section: Introductionmentioning

confidence: 99%

Neuroglobin, a Novel Intracellular Hexa-Coordinated Globin, Functions as a Tumor Suppressor in Hepatocellular Carcinoma via Raf/MAPK/Erk

et al. 2013

Self Cite

View full text Add to dashboard Cite

Hypoxia and oxidative stress are critical factors in carcinogenesis and exist throughout cancer development; however, the underlying mechanisms are far from clear. Here, for the first time to our knowledge, we reported that neuroglobin (Ngb), an intracellular hexa-coordinated globin serving as an oxygen/ reactive oxygen species (ROS) sensor, functions as a tumor suppressor in hepatocelluar carcinoma (HCC). Ngb protein and mRNA expression were significantly down-regulated in tumor tissues, compared with its adjacent non-tumor tissues of human HCC samples and normal liver tissues. Knock-down of Ngb by RNA interference promoted human HCC cell line (HepG2) growth and proliferation, G0/G1-S transition in vitro, and tumor growth in vivo. On the contrary, overexpression of Ngb suppressed HepG2 cell growth and proliferation, G0/G1-S transition, colony formation in vitro, and tumorigenicity in vivo. These results established a tumor suppressor function of Ngb in HCC.The underlying mechanisms were further investigated. Overexpression of Ngb suppressed Raf/MEK/extracellular signalregulated kinase (Erk), whereas knockdown of Ngb enhanced Raf/MEK/Erk activation in HepG2 cells in vitro and in vivo. Glutathione S-transferase pull-down showed that Ngb interacted with c-Raf-1 in HepG2 cells. Overexpression of Ngb suppressed serum-and H 2 O 2 -stimulated Erk activation in HepG2 cells. Pharmacological inhibition of Erk activation abolished the proliferative effect of Ngb knockdown in HepG2 cells. Mutation of Ngb at its oxygen-binding site (H64L) abolished the inhibitory effects of Ngb on Erk activation and HepG2 cell proliferation. Therefore, we propose that Ngb controls HCC development by linking oxygen/ROS signals to oncogenic Raf/mitogen-activated protein kinase (MAPK)/Erk signaling. Our data suggest that neuroglobin could be a new target for cancer therapy.

show abstract

Neuroglobin expression and function in the temporal cortex of bilirubin encephalopathy rats

Fan

Zhang

et al. 2021

The Anatomical Record

View full text Add to dashboard Cite

Bilirubin encephalopathy (BE) is a neurological syndrome in newborns, mainly caused by neuronal injury due to excessive oxidative stress produced by unconjugated bilirubin (UCB). Neuroglobin (NGB) can protect the brain by removing oxidative stress species, but its expression and significance in BE are not clear. To address this question, the neonatal BE model was established by injecting UCB into the cerebellomedullary cistern of 7‐day‐old SD rats. Rats were divided into a sham and BE 6 hr group, BE 12 hr group, BE 24 hr group, and BE 7 d group according to UCB action times. Hematoxylin/eosin and Nissl staining, and electron microscopy were employed to observe the pathological and ultrastructural changes of nerve cells in each group. Immunofluorescence staining was used to detect NGB expression sites and cell types. Western blotting and quantitative PCR served to detect NGB expression and test the mitochondrial apoptosis signal pathway. The results confirm that UCB can lead to pathological damage and ultrastructural changes in rats' temporal cortex, increasing the expression of apoptosis‐related proteins Bax, Bcl‐2, Cyt c, Caspase‐3, and neuronal NGB. UCB promotes NGB expression with an increase in action time and reach a peak at 12 hr. In summary, brain damage induced by UCB will cause an increase in NGB expression, the increasing NGB can inhibit neuron apoptosis in early BE phases. Therefore, promoting the expression of endogenous NGB, to act as a neuroprotective agent may be a potential treatment strategy for BE.

show abstract

Presence of neuroglobin in cultured astrocytes

Cited by 49 publications

References 15 publications

Silencing neuroglobin enhances neuronal vulnerability to oxidative injury by down-regulating 14-3-3γ

Silencing neuroglobin enhances neuronal vulnerability to oxidative injury by down-regulating 14-3-3γ

Neuroglobin, a Novel Intracellular Hexa-Coordinated Globin, Functions as a Tumor Suppressor in Hepatocellular Carcinoma via Raf/MAPK/Erk

Neuroglobin expression and function in the temporal cortex of bilirubin encephalopathy rats

Contact Info

Product

Resources

About