Presence of the Resistance GenesvanC1andpbp5in Phenotypically Vancomycin and Ampicillin SusceptibleEnterococcus faecalis

Abstract

Ampicillin and vancomycin are important antibiotics for the therapy of Enterococcus faecalis infections. The ampicillin resistance gene pbp5 is intrinsic in Enterococcus faecium. The vanC1 gene confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Both genes are chromosomally located. Resistance to ampicillin and vancomycin was determined in 484 E. faecalis of human and porcine origin by microdilution. Since E. faecalis are highly skilled to acquire resistance genes, all strains were investigated for the presence of pbp5 (and, in positive strains, for the penicillin-binding protein synthesis repressor gene psr) and vanC1 (and, in positive strains, for vanXYc and vanT) by using polymerase chain reaction (PCR). One porcine and one human isolate were phenotypically resistant to ampicillin; no strain was vancomycin resistant. Four E. faecalis (3/1 of porcine/human origin) carried pbp5 (MIC=1 mg/L), and four porcine strains were vanC1 positive (minimum inhibitory concentration [MIC]=1 mg/L). Real-time reverse transcriptase (RT)-PCR revealed that the genes were not expressed. The psr gene was absent in the four pbp5-positive strains; the vanXYc gene was absent in the four vanC1-positive strains. However, vanT of the vanC gene cluster was detected in two vanC1-positive strains. To our knowledge, this is the first report on the presence of pbp5, identical with the "E. faecium pbp5 gene," and of vanC1/vanT in E. faecalis. Even if resistance is not expressed in these strains, this study shows that E. faecalis have a strong ability to acquire resistance genes-and potentially to spread them to other bacteria. Therefore, close monitoring of this species should be continued.

Detection of vanC 1 gene transcription in vancomycin-susceptible Enterococcus faecalis

“…None of the strains tested positive by PCR for the vanA or vanB gene. The presence of the vanC 1 gene in vancomycin-susceptible E. faecalis strains isolated from pig manure samples was first described in Germany (Schwaiger et al 2012). The detection of these vanC genes in E. faecalis is remarkable because they are thought to be intrinsic to E. gallinarum ( vanC 1 ) and E. casseliflavus ( vanC 2/3 ) and the vanC operon is chromosomally located in a transferable region, such as a transposon and/or integron (Dutka-Malen et al 1992, Navarro & Courvalin 1994, Patel et al.…”

“…This flow of the vanC gene between species is important because the presence of this gene is often used to identify species and therefore, erroneous identification of species may be occurring. Furthermore, this flow also emphasises that the chromosomal location of a gene in intrinsically resistant strains does not necessarily protect against transfer to other species, thereby contributing to the diversification of species (Schwaiger et al 2012). …”

“…The vanC 1 gene was recently detected in a vancomycin-susceptible strain of E. faecalis (Schwaiger et al 2012). Here we report the presence of the vanC 1 and vanC 2/3 genes and evaluate the expression of vanC genes by reverse transcription-polymerase chain reaction (RT-PCR) in E. faecalis isolates that were obtained from cloacal swabs of broilers; these strains were previously classified as vancomycin-intermediate resistant (Cas-senego et al 2011).…”

Insusceptibility to disinfectants in bacteria from animals, food and humans—is there a link to antimicrobial resistance?

“…The transcription of eme A in relation to the transcription of DNA coding for a partial sequence of the 23S-rRNA was investigated by RT-PCR as previously described (Schwaiger et al, 2012), using the eme A-primers as described above and primers GTAGTCCACAGCTTCGGTAATATGT and AACTAGGATGTTGGCTTAG AAGCA for a 23S-rDNA-fragment as described elsewhere (Hancock et al, 2003). For a preliminary impression, differences in gene transcription were calculated using the 2 ∧ -DeltaDeltaCt-method.…”

“…At the same time, other studies did not find clear indications for co-resistance against antibiotics and disinfectants (Suller and Russell, 2000; Loughlin et al, 2002). Enterococci—apart from VRE—have rarely been investigated for this correlation up to now, despite the fact that enterococci are emerging—meanwhile maybe better called: “emerged”—nosocomial pathogens (Tailor et al, 1993; Willems and van Schaik, 2009) with a high recombination potential (Aarestrup et al, 2002; Leavis et al, 2006; Palmer and Gilmore, 2010; Schwaiger et al, 2011, 2012). …”