Preserved Glucoregulation but Attenuation of the Vascular Actions of Insulin in Mice Heterozygous for Knockout of the Insulin Receptor

Abstract

Type 2 diabetes is preceded by years of insulin resistance and is characterized by reduced bioavailability of the antiatherosclerotic signaling molecule nitric oxide (NO) and premature atherosclerosis. The relationship between resistance to the glucoregulatory actions of insulin and its effects on the vasculature (in particular NO-dependent responses) is poorly characterized. We studied this relationship in mice heterozygous for knockout of the insulin receptor (IRKO), which have a mild perturbation of insulin signaling. Male heterozygous IRKO mice aged 8 -12 weeks were compared with age-and sex-matched littermates. IRKO mice had fasting blood glucose, insulin, free fatty acid, and triglyceride levels similar to those of wild-type mice. Intraperitoneal glucose and insulin tolerance tests were also similar in the two groups. Insulin levels in response to a glucose load were approximately twofold higher in IRKO compared with wild-type mice (1.08 ؎ 0.11 vs. 0.62 ؎ 0.13 ng/ml; P ‫؍‬ 0.004). Despite this mild metabolic phenotype, IRKO mice had increased systolic blood pressure (124 ؎ 4 vs. 110 ؎ 3 mmHg; P ‫؍‬ 0.01). Basal NO bioactivity, assessed from the increase in tension of phenylephrine preconstricted aortic rings in response to the NO synthase inhibitor N G -monomethyl-L-arginine, was reduced in IRKO (61 ؎ 14 vs. 152 ؎ 30%; P ‫؍‬ 0.005). Insulin-mediated NO release in aorta, assessed as the reduction in phenylephrine constrictor response after insulin preincubation, was lost in IRKO mice (5 ؎ 8% change vs. 66 ؎ 9% reduction in wild-type; P ‫؍‬ 0.03). Insulin-stimulated aortic endothelial NO synthase phosphorylation was also significantly blunted in IRKO mice (P < 0.05). These data demonstrate that insulin-stimulated NO responses in the vasculature are exquisitely sensitive to changes in insulin-signaling pathways in contrast to the glucoregulatory actions of insulin. These findings underscore the importance of early intervention in insulin-resistant states, where glucose homeostasis may be normal but substantial abnormalities of the vascular effects of insulin may already be present.

Effect of Endothelium-Specific Insulin Resistance on Endothelial Function In Vivo

“…Aortic vascular function. Vascular function was studied in aortic rings mounted in an organ bath as described previously (20,21). Cumulative dose responses to phenylepherine (1 nmol/l to 10 mol/l) were measured.…”

“…Plasma insulin was measured by enzyme-linked immunoassay using mouse insulin standards. Fasting triglycerides and fasting free fatty acids were measured by colorimetry (20,21). Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated from fasting insulin and glucose measurements.…”

“…Blood pressure. Systolic blood pressure was measured using tail cuff plethysmography (20,21). Aortic vascular function.…”

“…Real-time PCR analysis of endothelial NO synthase (eNOS), NOX2, NOX4, and ␤-actin expression was performed (eNOS forward, GGGAAAGCTGCAG-GTATTTGAT, and reverse, CACTGTGATGGCTGAACGAAGA; Nox2 forward, ACTCCTTGGGTCAGCACTGG, and reverse, GTTCCTGTCCAGTTGTCTTCG; Nox4 forward, TGAACTACAGTGAAGATTTCCTTGAAC, and reverse, GA-CACCCGTCAGACCAGGAAT; and ␤-actin forward, CGTGAAAAGATGACCCA-GATCA, and reverse, TGGTACGACCAGAGGCATACAG) (20). The standard curve method was used, and results are normalized to ␤-actin expression.…”

“…All studies were comparisons of male ESMIRO mice aged 8 -10 weeks and ageand sex-matched wild-type littermates. Morphological assessment was performed in 8-to 10-week-old male mice (20). Two lines of ESMIRO mice were generated, and experiments were performed in both lines to exclude a positional effect of transgene integration into the murine genome.…”