Prevalence and identification of tetracycline-resistant oral bacteria in children not receiving antibiotic therapy

Lancaster, Holli; Ready, Derren; Mullany, Peter; Spratt, David A.; Bedi, Raman; Wilson, Michael

doi:10.1016/s0378-1097(03)00740-7

Cited by 36 publications

(30 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The oral cavity harbors a diverse community of microorganisms and has been shown to be a reservoir for antibiotic-resistant bacteria (5,9,14). The most widespread tetracycline resistance (Tc r ) gene identified from oral bacteria is tet(M) (9,17,19). It has been identified in 42 genera (16) and is usually found on conjugative transposons of the Tn916/ Tn1545 family (4).…”

Section: ؊5mentioning

confidence: 99%

Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity

Ready

Pratten

Roberts

et al. 2006

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Twelve out of 96 Veillonella spp. isolated from oral samples harbored tetracycline resistance genes. The most common resistance gene was tet(M). A tet(M)-positive Veillonella dispar strain was shown to transfer a Tn916-like element to four Streptococcus spp. by conjugation at a frequency of 5.2 ؋ 10 ؊6 to 4.5 ؋ 10 ؊5per recipient.The tetracyclines are broad-spectrum, bacteriostatic antibiotics used for the treatment of skin, respiratory, and oral infections (18); however, bacterial resistance is limiting their usefulness. The oral cavity harbors a diverse community of microorganisms and has been shown to be a reservoir for antibiotic-resistant bacteria (5,9,14). The most widespread tetracycline resistance (Tc r ) gene identified from oral bacteria is tet(M) (9,17,19). It has been identified in 42 genera (16) and is usually found on conjugative transposons of the Tn916/ Tn1545 family (4). Transfer of Tn916-like elements between oral streptococci has been observed (7,8,15). However, the role of oral bacteria other than streptococci in the transfer of Tc r genes has not been thoroughly investigated. Previous work has shown that the most prevalent group of tetracycline-resistant oral bacteria, other than the oral streptococci, are Veillonella spp. (9). Veillonella spp. are anaerobic, gram-negative cocci and are residents of the oral cavity, gastrointestinal tract, and vagina (2). The aim of this study was to determine if oral Veillonella spp. harbored transferable Tc r . Ninety-six Veillonella isolates were tested for Tc r . The isolates were recovered from the dental plaque of 52 healthy subjects who had not received antibiotics in the previous three months (ethical approval 98/56 [Local Health Authority Research and Ethics Committee]). Of these isolates, 12.5% were shown to be tetracycline resistant by agar dilution (12) (MIC Ն 16 g/ml), and five different Tc r genes were detected (Table 1) by PCR and sequencing using previously published primers (13,19). The most common Tc r gene was tet(M), followed by tet(S) ( Table 1). Veillonella dispar (34.2A) containing tet(M) was used as a donor of Tc r . The genetic support for tet(M) was demonstrated by PCR. Reactions were carried out to amplify the region from the start of tet(M) to the int gene using previously published primer pairs RT1 and RT2, RT3 and RT4 (15), orf6 (5Ј TGGATATTTGTGTCCTGTATGTG) and xis (5Ј CGTAGCTTGTTTTCGCCAAT), and intxis1 and intxis2 (15). The results of the PCR and sequencing demonstrated that the tet(M) gene was likely to be contained within a Tn916-like conjugative transposon.Determination of conjugative transfer of the Tn916-like element from V. dispar to four oral streptococci (Table 2) was achieved by filter-mating and transformation experiments in the presence and absence of DNase I. The donor V. dispar 34.2A (MIC, 32 g/ml) was grown anaerobically overnight on tetracycline containing anaerobic agar (8 g/ml; Oxoid Ltd., Basingstoke, United Kingdom) supplemented with 5% defibrinated horse blood (E&O Laboratories, Bonnybridge, United Kingdom)....

show abstract

Section: ؊5mentioning

confidence: 99%

Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity

Ready

Pratten

Roberts

et al. 2006

Antimicrob Agents Chemother

View full text Add to dashboard Cite

show abstract

“…Therefore, it is becoming recognized that commensal bacteria likely play a key role in the evolution and dissemination of genetic elements, including AR genes, in microbial ecosystems (2,18,22,25,33,36,37). While the large AR gene pools in food animals, lagoon water, and farm manures (1,6,13,25,29,34) might be related to exposure to growth-promoting antibiotics, the high prevalence of ART bacteria in oral and fecal samples from healthy human subjects and wild animals without a recent history of antibiotic exposure (3,9,11,14,28,30,32) suggests that there might be major knowledge gaps regarding AR acquisition and circulation pathways involving human and animal hosts. In fact, recent studies revealed a large number and broad spectrum of food-borne ART commensal bacteria with resistance-encoding genes in conventional retail foods, including many ready-to-consume items, suggesting that humans are constantly exposed to ART bacteria through daily food intake (8,16,37).…”

mentioning

confidence: 99%

Acquired Antibiotic Resistance: Are We Born with It?

Zhang

Kinkelaar

Huang

et al. 2011

Appl Environ Microbiol

120

102

View full text Add to dashboard Cite

The rapid emergence of antibiotic resistance (AR) is a major public health concern. Recent findings on the prevalence of food-borne antibiotic-resistant (ART) commensal bacteria in ready-to-consume food products suggested that daily food consumption likely serves as a major avenue for dissemination of ART bacteria from the food chain to human hosts. To properly assess the impact of various factors, including the food chain, on AR development in hosts, it is important to determine the baseline of ART bacteria in the human gastrointestinal (GI) tract. We thus examined the gut microbiota of 16 infant subjects, from the newborn stage to 1 year of age, who fed on breast milk and/or infant formula during the early stages of development and had no prior exposure to antibiotics. Predominant bacterial populations resistant to several antibiotics and multiple resistance genes were found in the infant GI tracts within the first week of age. Several ART population transitions were also observed in the absence of antibiotic exposure and dietary changes. Representative AR gene pools including tet(M), ermB, sul2, and bla TEM were detected in infant subjects. Enterococcus spp., Staphylococcus spp., Klebsiella spp., Streptococcus spp., and Escherichia coli/Shigella spp. were among the identified AR gene carriers. ART bacteria were not detected in the infant formula and infant foods examined, but small numbers of skin-associated ART bacteria were found in certain breast milk samples. The data suggest that the early development of AR in the human gut microbiota is independent of infants' exposure to antibiotics but is likely impacted by exposure to maternal and environmental microbes during and after delivery and that the ART population is significantly amplified within the host even in the absence of antibiotic selective pressure.

show abstract

“…is the most extensively studied antibiotic resistance gene in terms of molecular ecology 9) and has been found among numerous species of Gram-negative and Gram-positive bacteria including not only human pathogens 6,20,22,38) but also bacteria obtained from several terrestrial environments associated with human activity 9) such as in agriculture 33) , groundwater 8) , and daily diets 14,16,26,39) . Tet(M) is often accompanied by mobile elements such as plasmids and transposons, such associations contributing to the wide distribution of this gene in bacterial genera obtained from different environments 9) .…”

mentioning

confidence: 99%

Distribution of Tetracycline Resistance Gene, tet(M), in Gram-Positive and Gram-Negative Bacteria Isolated from Sediment and Seawater at a Coastal Aquaculture Site in Japan

2007

View full text Add to dashboard Cite

We found increased numbers of oxytetracycline (OTC)-resistant bacteria in sediment and seawater around a marine aquaculture site after OTC therapy. Samples were collected at an aquaculture site along the coast of the Seto Inland Sea, Japan in 2004. In April, the percentage of bacteria resistant to 60 µg mL −1 OTC in the surface sediment was 6.8%-20.0%. The percentages increased during OTC therapy in the summer reaching 53.3%-60.7% in September. Ninety-two days after drug cessation, the percentages decreased to below 22.9%. Tet(M)-positive bacteria were detected in the sediment and seawater samples. Tet(M) was evident in both Gram-positive and Gram-negative bacteria from various genera, and was newly identified in Paenibacillus, Sporosarcina, Shewanella, and Pseudoalteromonas. The dominant tet(M)-positive isolates were strains of Vibrio suggesting that this genus is an important reservoir for tet(M) in the marine environment. Two different alleles were found, tet(M)-A and tet(M)-B, each in isolates from five genera. The data suggests drug therapy used in the aquaculture acted as a selective pressure promoting increased numbers of resistant bacteria.

show abstract

Prevalence and identification of tetracycline-resistant oral bacteria in children not receiving antibiotic therapy

Cited by 36 publications

References 33 publications

Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity

Potential Role of Veillonella spp. as a Reservoir of Transferable Tetracycline Resistance in the Oral Cavity

Acquired Antibiotic Resistance: Are We Born with It?

Distribution of Tetracycline Resistance Gene, tet(M), in Gram-Positive and Gram-Negative Bacteria Isolated from Sediment and Seawater at a Coastal Aquaculture Site in Japan

Contact Info

Product

Resources

About