Prevention of Orthotopic Liver Allograft Rejection in Rats With a Short-Term Brequinar Sodium Therapy

Shirwan, Haval; Cosenza, Carlos Alberto Nunes; Wang, Hong K.; Wu, Guey-Shuang; Makowka, Leonard; Cramer, Donald V.

doi:10.1097/00007890-199404150-00016

Cited by 6 publications

(4 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The immunological activation markersthe appearance of IL-2-R, class I1 increase, and ICAM-1 inductionsupported the cellular findings. The appearance of IL-2-receptor expression in the graft has also been shown to correlate with acute rejection of the rat liver [18]. The upregulation of class I1 and ICAM-1, recognized in human and rat allografts [l, 14,16,17,191, followed the overall course of immune activation in the FNAB.…”

Section: Discussionmentioning

confidence: 99%

A rat model of monitoring liver allograft rejection

Martelius

Mäkisalo

Höckerstedt

et al. 1997

Transplant International

View full text Add to dashboard Cite

Rat models are often used to study liver allograft rejection. We have established a model for rat liver allograft rejection, monitored by fine needle aspiration biopsy (FNAB), in the strain combination PVG-to-BN with a mean survival time of 37 k 20 days. In this model, we observed acute rejection with an intense peak of lymphoid blasts and lymphocyte-dominated inflammation in the FNAB [9.1 f 3.0 corrected increment units (CIU)], and an eventual increase in macrophages (up to 4.2 f 4.4 CIU), together with fibrosis and parenchymal necrosis in the graft. Markers of immune activation, such as an increase in IL-2-receptor (from 1 YO f 2 YO to 21 % f 13 YO) and class I1 (from 20 YO & 9 Yo to 43 % f 13 Yo) expressing lymphoid cells and induction of ICAM-1 in the graft, were consistent with the overall cellular response. The FNAB correlated well with parallel graft histology. In this rat model, the atraumatic monitoring makes a close follow-up possible without having to sacrifice the experimental animals. This saves work, animals, and costs in the study of liver rejection.

show abstract

Section: Discussionmentioning

confidence: 99%

A rat model of monitoring liver allograft rejection

Martelius

Mäkisalo

Höckerstedt

et al. 1997

Transplant International

View full text Add to dashboard Cite

show abstract

“…PCR amplification was performed in a 100‐ μ l reaction mixture containing 200 μ m of each of the regular dNTPs, 10 pmol of each rat primers, and 2·5 U Taq DNA polymerase (TaKaRa, Otsu, Shigma, Japan). The nucleotide sequences of the primers (IL‐2, sense 5′‐CAGCTGTTGCTGGACTTACAGG‐3′, antisense 5′‐CACAGTTGATGGCTCATCATCG‐3′; IFN‐ γ , sense 5′‐GGATATCTGGAGGAACTGGCAAAAG‐3′, antisense 5′‐GCTAGATTCTGGTGACAGCTGGTG‐3′; perforin, sense 5′‐TGCTACACTGCCACTCGGTCA‐3′, antisense 5′‐GCATGCTCTGTGGAGCTGTTA‐3′; granzyme B, sense 5′‐GACTTTGTGCTGACTGCTGCTCAC‐3′, antisense: 5′‐TTGTCCATAGGAGACGATGCCCGC‐3′; β ‐actin, sense 5′‐CATCGTGGGCCGCTCTAGGCA‐3′, antisense 5′‐CCGGCCAGCCAAGTCCAGACGC‐3′) have been published elsewhere [11]. We used the TaKaRa Thermal Cycler 480 PCR system and the ‘hot start’ technique [12] to increase specificity.…”

Section: Methodsmentioning

confidence: 99%

“…PCR amplification was performed in a 100-m l reaction mixture containing 200 mm of each of the regular dNTPs, 10 pmol of each rat primers, and 2´5 U Taq DNA polymerase (TaKaRa, Otsu, Shigma, Japan). The nucleotide sequences of the primers (IL-2, sense 5 H -CAGCTGTTGCTGGACTTACAGG-3 H , [11]. We used the TaKaRa Thermal Cycler 480 PCR system and the`hot start' technique [12] to increase specificity.…”

Section: Rt-pcrmentioning

confidence: 99%

Induction of lymphocyte apoptosis in rat liver allograft with ongoing rejection by FTY720

Li¹,

Tamura²,

Fujino³

et al. 2001

Clinical and Experimental Immunology

View full text Add to dashboard Cite

SUMMARYThe action mechanism of FTY720, a novel immunosuppressant, is completely different from conventional immunosuppressants. The drug, which triggers apoptosis in murine and human lymphocytes, has a potent immunosuppressive activity to prevent allograft rejection without any severe side-effect. The present study was designed to determine whether FTY720 induces apoptotic cell death in activated lymphocytes infiltrated into liver grafts with ongoing rejection. FTY720 was orally administered at 5 mg/kg to the recipients on day 3 and day 4 after grafting, when the graft rejection was histologically confirmed. The intragraft patterns of IL-2, interferon-gamma (IFN-g), perforin, and granzyme B gene expression were detected by reverse transcriptase-polymerase chain reaction. The treatment reversed ongoing rejection and significantly prolonged recipient survival time compared with the control group. Light microscopic observation of the graft sections stained with the DNA nick-end labelling method showed that the apoptosis in the control allografts was mainly induced in hepatocytes, while that in the FTY720-treated allografts was in infiltrated lymphocytes. The rejection therapy with FTY720 did not alter the expression of IL-2, IFN-g, and perforin mRNAs, but slightly decreased granzyme B expression. Our results suggest that FTY720 does not alter the intrinsic lymphocyte function to produce the rejection-related cytokines, but strongly induces apoptotic cell death in the activated lymphocytes. Thus, FTY720 affords new insight into the mechanisms underlying improvements in immunosuppressive treatments.

show abstract

“…In fact, a number of reports have suggested that IL-4 is associated with graft acceptance. [17][18][19][32][33] Maeda et al have recently shown that the adoptive transfer of a TH2-like cell line can prolong class II disparate mouse skin allografts. 34 More interestingly, our results suggest that TH1mediated rejection by IL-2 and IL-12 may involve distinct immunological effector pathways.…”

Section: Il-2 and Il-12 In Mouse Liver Transplantationmentioning

confidence: 99%

Interleukin-2 and interleukin-12 mediate distinct effector mechanisms of liver allograft rejection

Thai¹,

Li²,

Fu³

et al. 1997

Liver Transpl

View full text Add to dashboard Cite

Interleukin-2 (IL-2), interleukin-12 (IL-12) or interleukin-4 (IL-4) were administered postoperatively to otherwise spontaneously accepting mouse liver allograft recipients (C57BL/10 = C3H) to test whether TH1 cytokines are critical mediators of rejection in this model. The induction of rejection at days 5 to 7 by exogenously administered IL-2 and IL-12, but not IL-4, suggests that mouse liver allograft rejection can be induced by TH1 cytokines; however, there appeared to be differences in the mechanism by which these cytokines induce liver rejection. IL-2 administration was accompanied by an increased intragraft infiltration of CD4؉ and CD8؉ cells and an up-regulation of natural killer (NK), lymphokine-activated killer (LAK), allospecific cytotoxic killer (CTL) activity and perforin mRNA when compared with mediatreated controls. In contrast, exogenous IL-12 treatment was associated with a suppression of CTL, NK, and LAK activity compared with controls but an enhanced infiltration of F4/80؉ macrophages as determined by immunohistochemistry. Determination of cytokine mRNA profiles by semiquantitative reverse transcription polymerase chain reaction showed the up-regulation of interferon (IFN)-␥, IL-4, IL-6, and IL-10 mRNA with IL-2 treatment when compared with media-treated controls. Interestingly, IL-2 mRNA was down-regulated in these animals, suggesting a negative feedback mechanism in IL-2 regulation. IL-12 treatment resulted in the up-regulation of IFN-␥, IL-6, and IL-10 mRNA, but not IL-2 or IL-4 mRNA. Higher complement-directed cytotoxic antibody titers were seen in IL-12-treated recipients compared with controls, whereas IL-2 treatment showed no apparent differences in antibody titers compared with media treatment. These in vivo observations were mimicked in a mixed leukocyte reaction by supplementing the reaction with IL-2, IL-12, or media. These results suggest that rejection of mouse liver allografts may involve more than one distinct cellular immunological effector mechanism. One is mediated by IL-2 and appears to favor alloreactive CTL, whereas the other pathway is mediated by IL-12/IFN-␥ and involves macrophages and cytotoxic antibodies largely resembling a delayed-type hypersensitivity reaction.

show abstract

Prevention of Orthotopic Liver Allograft Rejection in Rats With a Short-Term Brequinar Sodium Therapy

Cited by 6 publications

References 0 publications

A rat model of monitoring liver allograft rejection

A rat model of monitoring liver allograft rejection

Induction of lymphocyte apoptosis in rat liver allograft with ongoing rejection by FTY720

Interleukin-2 and interleukin-12 mediate distinct effector mechanisms of liver allograft rejection

Contact Info

Product

Resources

About