Production of HIV-1 vif mRNA Is Modulated by Natural Nucleotide Variations and SLSA1 RNA Structure in SA1D2prox Genomic Region

Abstract

Genomic RNA of HIV-1 contains localized structures critical for viral replication. Its structural analysis has demonstrated a stem-loop structure, SLSA1, in a nearby region of HIV-1 genomic splicing acceptor 1 (SA1). We have previously shown that the expression level of vif mRNA is considerably altered by some natural single-nucleotide variations (nSNVs) clustering in SLSA1 structure. In this study, besides eleven nSNVs previously identified by us, we totally found nine new nSNVs in the SLSA1-containing sequence from SA1, splicing donor 2, and through to the start codon of Vif that significantly affect the vif mRNA level, and designated the sequence SA1D2prox (142 nucleotides for HIV-1 NL4-3). We then examined by extensive variant and mutagenesis analyses how SA1D2prox sequence and SLSA1 secondary structure are related to vif mRNA level. While the secondary structure and stability of SLSA1 was largely changed by nSNVs and artificial mutations introduced to restore the original NL4-3 form from altered ones by nSNVs, no clear association of the two SLSA1 properties with vif mRNA level was observed. In contrast, when naturally occurring SA1D2prox sequences that contain multiple nSNVs were examined, we attained significant inverse correlation between the vif level and SLSA1 stability. These results may suggest that SA1D2prox sequence adapts over time, and also that the altered SA1D2prox sequence, SLSA1 stability, and vif level are mutually related. In total, we show here that the entire SA1D2prox sequence and SLSA1 stability critically contribute to the modulation of vif mRNA level.

Expression Level of HIV-1 Vif Can Be Fluctuated by Natural Nucleotide Variations in the vif-Coding and Regulatory SA1D2prox Sequences of the Proviral Genome

“…By utilizing sequences of both regions from HIV-1 subtypes B (NL4-3) and C (Indie) viruses with different anti-A3G activity, we generated chimeric proviral clones with the backbone of NL4-3 (Figure 1). Together with our previous reports (Nomaguchi et al, 2014, 2016, 2017), our results suggest that viral nucleotide sequences of both SA1D2prox and vif coding-region contribute to determining Vif expression level and consequently affecting HIV-1 replication (Figure 2). Interestingly, when natural Vif variants were expressed by a certain expression vector, their expression levels were not uniform (Simon et al, 2005; Ooms et al, 2013).…”

“…Virological characteristics of NL4-3 and chimeric viral clones newly constructed. Most experiments here were performed similarly as described previously (Nomaguchi et al, 2014, 2016, 2017). (A) Semiquantitative PCR analysis.…”

“…We also observed the inverse correlation between levels of vif / vpr mRNAs and the Vif/A3G-dependent virus growth fluctuation (Widera et al, 2014; Nomaguchi et al, 2016). Moreover, we found that the RNA stem-loop structure formed in the region containing SA1 (Watts et al, 2009; Pollom et al, 2013) can contribute to determination of vif mRNA production level (Nomaguchi et al, 2017). On the one hand, sequence of vif -coding region also contains SA2/SD3 involved in vpr mRNA creation, and various SREs close to SA2/SD3 sites have been reported (Figure 1B; Karn and Stoltzfus, 2012; Sertznig et al, 2018).…”

The Expression Level of HIV-1 Vif Is Optimized by Nucleotide Changes in the Genomic SA1D2prox Region during the Viral Adaptation Process

“…HEK 293T cells were transfected with pcNLmini-RI or its variant clones. As described previously [ 38 , 39 ], at 16 hrs post-transfection, cells were lysed for RNA extraction, and subsequent cDNA synthesis using oligo (dT) primer. PCR amplification was done similarly as described previously utilizing the following primer sets: XbaI-NL675-5 (Forward) (GCTCTAGAGAGGAGATCTCTCGACGCAG) and NL741-3 (Reverse) (GTCGCCGCCCCTCGCCTC) for all transcripts; XbaI-NL675-5 (Forward) and Vif-qPCR-3 (Reverse) (ACCTGCCATCTGTTTTCCATA) for the full-length and D1/A1 splicing products; XbaI-NL675-5 (Forward) and NL5622-3 (Reverse) (GCTCTAGTGTCCATTCATTG) for the D1/A1-D2/A2 and D1/A2 splicing products.…”

“…Based on comparative sequence analyses of adaptive mutations that emerged in our HIV-1 adaptation system [ 36 ], we have identified a number of naturally-occurring single nucleotide mutations (nSNM) that vary the Vif expression levels within a region around the SA1 and SD2 sites located within the pol -integrase sequence, named the SA1D2prox region ( Figure 1 A). These nSNMs within SA1D2prox that alter the Vif expression levels also affect the replication potential depending on both their Vif expression levels and cellular A3G expression levels [ 37 , 38 , 39 , 40 ]. Pro-viral clones carrying nSNM are grouped into low-, high-, and excessive-Vif types, which express low, high, and extremely high levels of Vif, respectively.…”