Prognostic Impact of Cysteine Proteases Cathepsin B and Cathepsin L in Pancreatic Adenocarcinoma

Niedergethmann, Marco; Wostbrock, Birgit; Sturm, J.; Willeke, Frank; Post, Stefan; Hildenbrand, Ralf

doi:10.1097/00006676-200410000-00005

Cited by 78 publications

(69 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In oral squamous-cell carcinoma PAI-1 is a novel potential marker of initial invasion (Lindberg et al, 2006). As previously reported by our group (Niedergethmann et al, 2004), similar to plasminogen and cathepsin B/C and their inhibitors, the serine proteases are of paramount importance in local invasion and metastases in PDAC. Takeuchi et al (1993) could already demonstrate a high PAI-1 expression in human pancreatic carcinomas in an immunohistochemical study.…”

Section: Discussionmentioning

confidence: 66%

Gene expression profiling of liver metastases and tumour invasion in pancreatic cancer using an orthotopic SCID mouse model

et al. 2007

View full text Add to dashboard Cite

The prognosis of pancreatic adenocarcinoma is affected by early metastases and local tumour invasion beyond surgical margins. Gene expression profiling in pancreatic cancer tissue is complicated due to the high amount of RNAses being present in human tissue and that of suitable models. In order to demonstrate early metastases, the models should take into account the anatomical environment of the tumour. Using the orthotopic transplantation of pancreatic tumour cells in SCID (severe combined immunodeficiency) mice, these interactions are taken into consideration. In order to identify genes associated with local tumour invasion and metastases in ductal pancreatic cancer, we investigated a human pancreatic tumour cell line derived from an orthopic pancreatic tumour model in SCID mice. Differential gene expression was performed on the basis of microarray technique. The human MiaPaca-2 cell line was implanted orthotopically in SCID mice. Transcriptional profiling was performed on fresh frozen tissue derived from the primary tumour, the tumour invasion front and the liver metastases. Differentially expressed genes were identified using statistical analyses, and were validated with external databases and with immunohistochemistry. A total of 1066 of 14 500 genes were significantly differentially expressed. Comparing the primary tumour with the tumour invasion front, there were 614 statistically significant up-and 348 downregulated genes. Twenty-five statistically significant up-and 181 downregulated genes were identified comparing the liver metastases with the primary tumour. Eight genes (PAI-1, BNIP3l, VEGF, NSE, RGS4, HSP27, GADD45A, PTPN14) were chosen and validated in a semi-quantitative immunohistochemical analysis, which revealed a positive correlation to the array data. Overrepresentation analyses revealed a total of 66 significantly regulated pathways associated with cell proliferation, cell stress, cell communication metabolic and cytokine function. In conclusion, model marker genes for local invasion and liver metastases can be identified using transcriptional profiling in the SCID mouse. Overrepresentation analysis secures a good and fast overview about the significantly regulated genes and can assign genes to certain pathways. These marker genes can be related to the apoptotic cascade, angiogenesis and cell interaction.

show abstract

Section: Discussionmentioning

confidence: 66%

Gene expression profiling of liver metastases and tumour invasion in pancreatic cancer using an orthotopic SCID mouse model

et al. 2007

View full text Add to dashboard Cite

show abstract

“…Therefore, our unique diagnostic strategy for the detection of high grade mPanINs can be translated directly into the clinic. Because cathepsin B and L have been shown to be independent prognostic factors of poor patient outcome in pancreatic cancer (23,24), in vivo imaging of cathepsin activity may also provide additional information about the prognosis of the respective patient.…”

Section: Discussionmentioning

confidence: 99%

In vivo diagnosis of murine pancreatic intraepithelial neoplasia and early-stage pancreatic cancer by molecular imaging

Eser

Messer²,

Eser³

et al. 2011

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Pancreatic ductal adenocarcinoma (PDAC) is a fatal disease with poor patient outcome often resulting from late diagnosis in advanced stages. To date methods to diagnose early-stage PDAC are limited and in vivo detection of pancreatic intraepithelial neoplasia (PanIN), a preinvasive precursor of PDAC, is impossible. Using a cathepsin-activatable near-infrared probe in combination with flexible confocal fluorescence lasermicroscopy (CFL) in a genetically defined mouse model of PDAC we were able to detect and grade murine PanIN lesions in real time in vivo. Our diagnostic approach is highly sensitive and specific and proved superior to clinically established fluorescein-enhanced imaging. Translation of this endoscopic technique into the clinic should tremendously improve detection of pancreatic neoplasia, thus reforming management of patients at risk for PDAC. is one of the deadliest human malignancies, with an extremely poor 5-y survival rate below 5% (1). Because patients generally present with symptoms relating to late stages of the disease, diagnosis of resectable PDAC is achieved in less than 15% of cases (1). However, investigators have reported that diagnosis and resection of early-stage PDAC (<2 cm in size) can result in a 4-y survival rate of up to 78% (2-5). These data suggest that early detection of PDAC can improve patient outcome. In addition, it has been shown that resection of PDAC combined with adjuvant chemotherapy can improve 5-y survival rates to 25%. Thus, increasing the chance of resection will lead to improved survival.Of the more than 33,000 new cases of PDAC diagnosed in the United States every year, ∼10% occur in families with a high prevalence of PDAC and are thus referred to as familial (6, 7). In a cohort study of twins, it was proposed that inherited factors may be responsible for up to 36% of pancreatic cancers, suggesting that the incidence of familial pancreatic cancer may be even higher than presently assumed (8). To date, several conditions associated with familial PDAC have been described and groups of individuals at low, moderate, or high risk for developing the disease have been defined (9, 10). Although clinical trials are currently testing screening protocols for the high-risk group, aimed at detecting curable precursors of PDAC such as intraductal papillary mucinous neoplasia, pancreatic intraepithelial neoplasia (PanIN), and early-stage PDAC (10-12), the results of these trials show that early lesions are often missed. Furthermore, false positive findings can lead to overtreatment of a significant fraction of the screened population (12). These findings show that better diagnostic tools for the detection of preneoplastic lesions and early-stage PDAC are urgently needed. Recent data demonstrate that preinvasive precursors progress slowly over many years to decades to invasive pancreatic cancer (13). The parental pancreatic cancer founder clone then requires more than 5 y to acquire the capacity to metastasize (13). Thus, there is a time frame of several years for the diagnosi...

show abstract

“…Cathepsin B-A cRNA probe was synthesized from cathepsin B cDNA (Ctsb) cloned in pCMV-SPORT6 vector (ATCC MGC-6211). We identified a specific region of Ctsb for an in situ hybridization (ISH) probe based on two criteria: (1) homology to the region of the human CSTB gene that was used in the literature (Niedergethmann, et al, 2004), and (2) the lack of cross-reactivity with any other mouse gene, as determined by an extensive BLAST search against mouse genome specific sequences using Vector NTI software. Oligonucleotides complementary to regions of Ctsb 195-215 bps (5′GCTGTCGGATGACCTGATTA 3′) and 657-677 bps (5′GGAGGGATGGTGTATGGTAA3′) (QIAGEN, Alameda, CA) were used in a PCR reaction (Platinum ® PCR SuperMix High Fidelity Kit, Invitrogen, CA; cat.…”

Section: Immunohistochemistrymentioning

confidence: 99%

Regulation of cysteine cathepsin expression by oxidative stress in the retinal pigment epithelium/choroid of the mouse

Alizadeh

Smit-McBride

Oltjen

et al. 2006

Experimental Eye Research

View full text Add to dashboard Cite

Cystatin C is the major inhibitor of the cysteine cathepsins. Polymorphisms in the cystatin C gene have recently been associated with the risk of developing Age-related Macular Degeneration (AMD). Oxidative stress is also thought to play a key role in the pathogenesis of AMD. We surveyed the retinal pigment epithelium (RPE) and choroid of the C57BL/6J mouse for the expression of the cysteine cathepsins under normoxic and hyperoxic (75% O 2 ) conditions. Microarray analysis of RPE/ choroid mRNA revealed the expression of cathepsins B and L, as well as cystatin C under all experimental conditions. The microarray results were confirmed by real-time quantitative polymerase chain reaction (PCR). Localization of the mRNA species for cystatin C and cathepsin B, as well as, localization of protein species for cystatin C, cathepsin B and L were performed to evaluate the tissue distribution of these species.Our results indicate that cystatin C is largely synthesized in the RPE and secreted from the basal side. Cathepsin B is the major cysteine protease in the RPE and choroid. The expression of all mRNAs and proteins was elevated by exposure to oxidative stress.

show abstract

Prognostic Impact of Cysteine Proteases Cathepsin B and Cathepsin L in Pancreatic Adenocarcinoma

Cited by 78 publications

References 30 publications

Gene expression profiling of liver metastases and tumour invasion in pancreatic cancer using an orthotopic SCID mouse model

Gene expression profiling of liver metastases and tumour invasion in pancreatic cancer using an orthotopic SCID mouse model

In vivo diagnosis of murine pancreatic intraepithelial neoplasia and early-stage pancreatic cancer by molecular imaging

Regulation of cysteine cathepsin expression by oxidative stress in the retinal pigment epithelium/choroid of the mouse

Contact Info

Product

Resources

About