Progranulin mutation analysis: Identification of one novel mutation in exon 12 associated with frontotemporal dementia

Aswathy, P. M.; Jairani, Pushparajan Sulajamani; Raghavan, Sheela Kumari; Gopala, Srinivas; Srinivas, Priya; Mathuranath, P. S.

doi:10.1016/j.neurobiolaging.2015.11.026

Cited by 9 publications

(4 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…GRN mutations are rare in Asian cohorts and absent in Korea and Hong Kong [16][17][18][19][20][21]. Four GRN mutations were reportedly associated with positive family history of FTLD: the first was in 2 Chinese sisters with CBS [22], then a Japanese female individual with primary progressive aphasia and mother with dementia [17], a patient with bvFTD from South India [18], and a Japanese with primary progressive aphasia whose brother had CBS [23]. They would be category 2-3 by Goldman's criteria [6].…”

Section: Discussionmentioning

confidence: 99%

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Dominguez

et al. 2020

Dement Geriatr Cogn Disord

View full text Add to dashboard Cite

Background: Compared to Western populations, familial frontotemporal lobar degeneration (FTLD) is rare among Asians. Progranulin (GRN) gene mutation, which is a major cause of FTLD, is likewise rare. We present a family with FTLD from the Philippines with an autosomal dominant pattern of inheritance and GRN mutation and briefly review reports of GRN mutations in Asia. Case Presentation: The proband is 66 years old with progressive nonfluent aphasia (PNFA)-corticobasal syndrome . We assessed 3 generations of her pedigree and found 11 affected relatives with heterogenous phenotypes, usually behavioral variant frontotemporal dementia (FTD) and PNFA. Neuroimaging showed atrophy and hypometabolism consistent with FTD syndromes. White matter hyperintensities were seen in affected members even in the absence of vascular risk factors. A GRN mutation R110X was found in 6 members, 3 with symptoms and 3 were asymptomatic. Plasma GRN was low (<112 ng/mL) in all mutation carriers. No mutations were found in microtubule-associated protein tau, APP, PSEN1, and PSEN2 genes, and all were APOE3. Conclusion: This is the first Filipino family with autosomal dominant FTD documented with GRN mutation. Identifying families and cohorts would contribute to therapeutic developments in an area with FTD-GRN.

show abstract

Section: Discussionmentioning

confidence: 99%

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Dominguez

et al. 2020

Dement Geriatr Cogn Disord

View full text Add to dashboard Cite

show abstract

“…No pathogenic GRN mutations were reported in 2 studies of Korean patients with FTD, PSP or CBS (Kim et al, 2014(Kim et al, , 2010. In an Indian cohort of 11 FTD subjects, a novel GRN p.Gln503X mutation in exon 12 was reported in an Indian familial bvFTD patient with concomitant reduced plasma progranulin levels, leading to a mutation frequency of ~1% of total FTD cases and 6% of familial FTD cases (Aswathy et al, 2016).…”

Section: Two Novel Grn Mutations In 3 Patients With Bvftd and Nfvppa ...mentioning

confidence: 98%

Targeted exome sequencing reveals homozygous TREM2 R47C mutation presenting with behavioral variant frontotemporal dementia without bone involvement

Tan

Zhao

et al. 2018

Neurobiology of Aging

View full text Add to dashboard Cite

“…GRN mutations are rare in China [7], with a prevalence of just 1.2%-2.6% [15][16][17][18][19], and have been infrequently reported in other Asian countries including Japan, Philippines, India, and Korea (where they have never been observed) [20][21][22][23][24]. In contrast, GRN mutations are common in Western countries, accounting for 34.6% of mutations in patients with FTD in Western countries [25].…”

Section: U N C O R R E C T E D a U T H O R P R O O Fmentioning

confidence: 99%

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Chu

Nan

Jiang

et al. 2023

JAD

View full text Add to dashboard Cite

Background: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism in the patient’s left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient’s genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients—mostly female—with GRN mutations; the prevalence was 1.2% –2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.

show abstract

Progranulin mutation analysis: Identification of one novel mutation in exon 12 associated with frontotemporal dementia

Cited by 9 publications

References 11 publications

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Autosomal Dominant Frontotemporal Lobar Degeneration in a Filipino Family with Progranulin Mutation

Targeted exome sequencing reveals homozygous TREM2 R47C mutation presenting with behavioral variant frontotemporal dementia without bone involvement

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review

Contact Info

Product

Resources

About