Promoter hypermethylation and loss of<i>CD133</i>gene expression in colorectal cancers

Jeon, You Kyung; Kim, Sung Hee; Choi, Seung Ho; Kim, Kyung Hee; Yoo, Byong Chul; Ku, Ja Lok; Park, Jae Gahb

doi:10.3748/wjg.v16.i25.3153

Cited by 25 publications

(23 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This finding is concordant with previous study on colon cancer cell lines [31]. But, the correlation of CD133 mRNA with methylation was not statistically significant.…”

Section: Discussionsupporting

confidence: 91%

“…Real-time RT-PCR was performed [as described elsewhere [31] in 384 well PCR plates containing the Fast SYBR Green Master Mix (Applied Biosystems, California, USA), cDNA template, CD133 RT sense primer (5'-CTGGGGCTGCTGT TTATTATTCTG-3'), and CD133 RT antisense primer (5'-ACGCCTTGTCCTTGGTAGTGTTG-3') in a final volume of 10 μL. Each primer/cDNA set was set up in triplicate.…”

Section: Methodsmentioning

confidence: 99%

“…Methylation status of CD133 was assessed using pyrosequencing-based methylation analysis. We evaluated the methylation status of CpG sites in promoter P2 and exon 1B, as these sites have previously shown correlation with CD133 gene transcript [31]. All primers for pyrosequencing were designed with Pyrosequencing Assay Design (QIAGEN, Hilden, Germany).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

CD133 expression is not an independent prognostic factor in stage II and III colorectal cancer but may predict the better outcome in patients with adjuvant therapy

et al. 2013

View full text Add to dashboard Cite

BackgroundCancer stem cells (CSCs) are notorious for their capacity of tumor progression, metastasis or resistance to chemo-radiotherapy. However, the undisputed role of cancer stem marker, CD133, in colorectal cancers (CRCs) is not clear yet.MethodsWe assessed 271 surgically-resected stage II and III primary CRCs with (171) and without (100) adjuvant therapy after surgery. CD133 expression was analyzed by immunohistochemical (IHC) staining and real-time RT-PCR. CD133 promoter methylation was quantified by pyrosequencing.ResultsThe CD133 IHC expression was significantly correlated with mRNA expression (p=0.0257) and inversely correlated with the promoter methylation (p=0.0001). CD133 was expressed more frequently in rectal cancer (p=0.0035), and in moderately differentiated tumors (p=0.0378). In survival analysis, CD133 expression was not significantly correlated with overall survival (OS) (p=0.9689) as well as disease-free survival (DFS) (p=0.2103). However, CD133+ tumors were significantly associated with better OS in patients with adjuvant therapy compared to those without adjuvant therapy (p<0.0001, HR 0.125, 95% CI 0.052-0.299). But the patients with CD133- tumors did not show any significant difference of survival according to adjuvant therapy (p=0.055, HR 0.500, 95% CI 0.247-1.015).ConclusionsIn stage II and III CRCs, CD133 IHC expression may signify the benefit for adjuvant therapy although it is not an independent prognostic factor.

show abstract

“…This finding is concordant with previous study on colon cancer cell lines [31]. But, the correlation of CD133 mRNA with methylation was not statistically significant.…”

Section: Discussionsupporting

confidence: 91%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

CD133 expression is not an independent prognostic factor in stage II and III colorectal cancer but may predict the better outcome in patients with adjuvant therapy

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Strand separation and purification of the single-stranded template were facilitated using the Vacuum Prep Tool (Biotage, Uppsala, Sweden). The purified single-stranded template was then added to the sequencing mixture containing annealing buffer and the following sequencing primers: BRAF: 5’-GATTTTGGTCTAGCTACA-3’, LINE-1: 5’-AGTTAGGTGTGGGATATAGT-3’, IGFBP7: YGGGTGTTYGTTTATTTT-3’, hMLH1: 5’- AGTTATAGTTGAAGGAAGAA -3’, and CD133: 5’- GGGATATGGGGGTATAAAG -3’, as per published reports (Table 1), [19–21] then incubated at 85°C for 2 minutes, and allowed to cool to room temperature. Pyrosequencing was carried out in a PyroMark ID instrument (Biotage, Uppsala, Sweden), and the data were analyzed using sequence analysis software from the manufacturer.…”

Section: Methodsmentioning

confidence: 99%

Molecular characteristics of colorectal serrated polyps and hyperplastic polyps

Sambuudash

Kim²,

et al. 2016

Medicine

View full text Add to dashboard Cite

The serrated neoplasia pathway of colorectal carcinogenesis is characterized by BRAF mutation and aberrant DNA methylation, which have not been reported on Korean patients. The aim of this study was to investigate BRAF mutation and DNA methylation in colorectal serrated polyps and the right colon.Between 2005 and 2013, 146 colon polyps (47 tubular adenomas [TAs], 53 traditional serrated adenomas [TSAs], 17 sessile serrated adenomas/polyps [SSAs], and 29 hyperplastic polyps in the proximal colon [PHPs]) were collected from patients. Paraffin-embedded colon polyp tissue was used for DNA extraction. BRAF V600E mutation was identified through polymerase chain reaction (PCR) and pyrosequencing assay. The methylation status of the long interspersed nucleotide element-1, insulin-like growth factor binding protein 7 (IGFBP7), mutL homolog 1 (hMLH1), and CD133 genes were evaluated through disulfite conversion, PCR, and pyrosequencing assay.BRAF V600E mutation was found in 2.1% of TAs, 47.2% of TSAs, 41.2% of SSAs, and 20.7% of PHPs. TSA and SSA had higher BRAF mutation rates than did TA (P < 0.0001). TSA had higher BRAF mutation rates than did PHP (P = 0.018). IGFBP7 hypermethylation was found in 17% of TAs, 37.7% of TSAs, 88.2% of SSAs, and 37.5% of PHPs. TSA and SSA had higher hypermethylation of IGFBP7 than did TA (P = 0.021 and P < 0.0001, respectively). SSA had higher hypermethylation of IGFBP7 than did PHP (P = 0.002). hMLH1 hypermethylation was found in 2.1% of TAs, 5.7% of TSAs, 0% of SSAs, and 0% of PHPs. CD133 hypermethylation was found in 21.3% of TAs, 9.4% of TSAs, 35.3% of SSAs, and 17.4% of PHPs.BRAF mutation and methylation in TSA and SSA are different from those in PHP in Koreans. These findings suggested that PHP may have different molecular characteristics compared with other serrated polyps.

show abstract

“…Reverse transcription-PCR (RT-PCR) analysis of CD133 expression in 32 colorectal cancer cell lines showed positive results in approximately two-thirds of the lines, including COLO 205 cells, and undetectable or low levels of CD133 expression in the remaining, possibly due to gene silencing by promoter hypermethylation of the CD133 CpG island [20]. The present study aimed to establish an in vitro colon CSC model using COLO 205 cells cultivated under serum-free stem cell conditions to search for increased expression of genes that are likely to be involved in chemoresistance of CSCs.…”

Section: Introductionmentioning

confidence: 99%

Overexpression of CYP3A4 in a COLO 205 Colon Cancer Stem Cell Model in vitro

Olszewski

Liedauer

Ausch

et al. 2011

Cancers

View full text Add to dashboard Cite

Cancer stem cells (CSCs) seem to constitute a subpopulation of tumor cells that escape from chemotherapy and cause recurrent disease. Low proliferation rates, protection in a stem cell niche and overexpression of drug resistance proteins are considered to confer chemoresistance. We established an in vitro colon CSC-like model using the COLO 205 cell line, which revealed transiently increased expression of CD133 when transferred to serum-free stem cell culture medium. Assessment of global gene expression of COLO 205 cells under these conditions identified a set of upregulated genes including cytochrome P450 3A4 (CYP3A4) and aldehyde dehydrogenase 1A1 (ALDH1A1), as confirmed by real-time qPCR. ALDH1A1 is a CSC marker for certain tumor entities and confers resistance to cyclophosphamide. CYP3A4 is expressed in liver and colon and its overexpression seems particularly relevant in colon cancer, since it inactivates irinotecan and other xenobiotics, such as taxols and vinca alkaloids. In conclusion, this COLO 205 model provides evidence for CD133 induction concomitant with overexpression of CYP3A4, which, together with ATP-binding cassette, subfamily G, member 2 (ABCG2) and others, may have a role in chemoresistant colon CSCs and a negative impact on disease-free survival in colon cancer patients.

show abstract

Promoter hypermethylation and loss ofCD133gene expression in colorectal cancers

Abstract: Transcriptional repression of CD133 is caused by promoter hypermethylation of the CD133 CpG islands in some of colorectal cancer cell lines. The study may contribute to the understanding of the role of CD133 inactivation in the progression of colorectal cancers.

Cited by 25 publications

References 25 publications

CD133 expression is not an independent prognostic factor in stage II and III colorectal cancer but may predict the better outcome in patients with adjuvant therapy

CD133 expression is not an independent prognostic factor in stage II and III colorectal cancer but may predict the better outcome in patients with adjuvant therapy

Molecular characteristics of colorectal serrated polyps and hyperplastic polyps

Overexpression of CYP3A4 in a COLO 205 Colon Cancer Stem Cell Model in vitro

Contact Info

Product

Resources

About