Propagation and recovery of intact, infectious Epstein–Barr virus from prokaryotic to human cells

Delecluse, Henri Jacques; Hilsendegen, Tanja; Pich, Dagmar; Zeidler, Reinhard; Hammerschmidt, Wolfgang

doi:10.1073/pnas.95.14.8245

Cited by 433 publications

(572 citation statements)

References 28 publications

Supporting

Mentioning

566

Contrasting

Unclassified

Order By: Relevance

“…The stop codon of LMP1 was replaced with a linker GGCCAGAGTGGTCCCGGTGGT followed by the open reading frame of mRFP. The resulting maxi-EBV plasmid was checked by restriction analyses (data not shown) and then used to establish virus-producing 293 cell lines (Delecluse et al, 1998;Neuhierl et al, 2002;Dirmeier et al, 2003;Humme et al, 2003). Primary B cells were isolated from human blood according to the protocol provided in the Miltenyi Biotech Human B cell Isolation Kit II (MACS).…”

Section: Recombinant Ebvmentioning

confidence: 99%

The latent membrane protein 1 oncogene modifies B-cell physiology by regulating autophagy

2007

View full text Add to dashboard Cite

Epstein-Barr virus (EBV) is a herpes virus that is associated with several human cancers. Infection of B cells by EBV leads to their induction and maintenance of proliferation and requires the oncogene, latent membrane protein 1 (LMP1). LMP1 signals in a ligand-independent manner and is expressed at widely different levels in cells of a single clone. It is this unusual distribution that allows LMP1 to stimulate multiple, distinct pathways. Average levels of LMP1 induce proliferation while high levels induce cytostasis and inhibition of protein synthesis. These inhibitory pathways are induced by the six transmembrane domains of LMP1. We uncovered a novel function encoded by transmembrane domains 3-6 of LMP1; they induce autophagy in a dose-dependent manner and thus, modify the physiology of their host. Cells that express low levels of LMP1 display early stages of autophagy, autophagosomes; those that express high levels of this oncogene display late stages of autophagy, autolysosomes. Inhibition of autophagy in EBV-positive cells leads to an accumulation of LMP1 and a decreased ability to form colonies. These results indicate that LMP1's induction of autophagy contributes to its own regulation and that of its host cell.

show abstract

Section: Recombinant Ebvmentioning

confidence: 99%

The latent membrane protein 1 oncogene modifies B-cell physiology by regulating autophagy

2007

View full text Add to dashboard Cite

show abstract

“…293 cells infected with the R-KO virus (293 R-KO), Z-KO virus (293 Z-KO), and wild-type virus (293 WT) have been described previously (11,14). In the R-KO virus, nucleotides 103,638 to 105,083 (B95.8 coordinates [accession no.…”

Section: Methodsmentioning

confidence: 99%

The BRRF1 Early Gene of Epstein-Barr Virus Encodes a Transcription Factor That Enhances Induction of Lytic Infection by BRLF1

Hong¹,

Delecluse

Gruffat

et al. 2004

J Virol

Self Cite

View full text Add to dashboard Cite

The switch from the latent to the lytic form of Epstein-Barr virus (EBV) infection is mediated by expression of the viral immediate-early (IE) proteins, BZLF1 (Z) and BRLF1 (R). An EBV early protein, BRRF1 (Na), is encoded by the opposite strand of the BRLF1 intron, but the function of this nuclear protein in the viral life cycle is unknown. Here we demonstrate that Na enhances the R-mediated induction of lytic EBV infection in 293 cells latently infected with a recombinant EBV (R-KO) defective for the expression of both R and Na. Na also enhances R-induced lytic infections in a gastric carcinoma line (AGS) carrying the R-KO virus, although it has no effect in a Burkitt lymphoma line (BL-30) stably infected with the same mutant virus. We show that Na is a transcription factor that increases the ability of R to activate Z expression from the R-KO viral genome in 293 cells and that Na by itself activates the Z promoter (Zp) in EBV-negative cells. Na activation of Zp requires a CRE motif (ZII), and a consensus CRE motif is sufficient to transfer Na responsiveness to the heterologous E1b promoter. Furthermore, we show that Na enhances the transactivator function of a Gal4-c-Jun fusion protein but does not increase the transactivator function of other transcription factors (including ATF-1, ATF-2, and CREB) known to bind CRE motifs. Na expression in cells results in increased levels of a hyperphosphorylated form of c-Jun, suggesting a mechanism by which Na activates c-Jun. Our results indicate that Na is a transcription factor that activates the EBV Zp IE promoter through its effects on c-Jun and suggest that Na cooperates with BRLF1 to induce the lytic form of EBV infection in certain cell types.

show abstract

“…DNA was provided by W. Hammerschmidt (34). Homologous recombination was carried out in Escherichia coli as described previously (28).…”

Section: Genetic Manipulation Of Ebv-bac Dna and Cloning Of Hek293 Cementioning

confidence: 99%

Involvement of Jun Dimerization Protein 2 (JDP2) in the Maintenance of Epstein-Barr Virus Latency

Murata

Noda

Saito

et al. 2011

Journal of Biological Chemistry

View full text Add to dashboard Cite

Reactivation of the Epstein-Barr virus from latency is dependent on expression of the BZLF1 viral immediate-early protein.The BZLF1 promoter (Zp) normally exhibits only low basal activity but is activated in response to chemical inducers such as 12-O-tetradecanoylphorbol-13-acetate and calcium ionophore. We found that Jun dimerization protein 2 (JDP2) plays a significant role in suppressing Zp activity. Reporter, EMSA, and ChIP assays of a Zp mutant virus revealed JDP2 association with Zp at the ZII cis-element, a binding site for CREB/ATF/AP-1. Suppression of Zp activity by JDP2 correlated with HDAC3 association and reduced levels of histone acetylation. Although introduction of point mutations into the ZII element of the viral genome did not increase the level of BZLF1 production, silencing of endogenous JDP2 gene expression by RNA interference increased the levels of viral early gene products and viral DNA replication. These results indicate that JDP2 plays a role as a repressor of Zp and that its replacement by CREB/ ATF/AP-1 at ZII is crucial to triggering reactivation from latency to lytic replication.The Epstein-Barr virus (EBV) 2 is a human ␥-herpesvirus that predominantly establishes latent infection in B lymphocytes. Only a small percentage of infected cells switch from the latent stage into the lytic cycle to produce progeny viruses. Although the mechanism of EBV reactivation in vivo is not fully understood, it is known to be elicited by treatment of latently infected B cells with chemical or biological reagents, such as 12-O-tetradecanoylphorbol 13-acetate (TPA), calcium ionophore, sodium butyrate, or anti-immunoglobulin, at least in cultured cells. Stimulation of the EBV lytic cascade by any of these leads to expression of two immediate-early genes, BZLF1 and BRLF1.The BZLF1 protein is a transcriptional activator that shares structural similarities to basic leucine zipper (b-Zip) family transcriptional factors and acts as an oriLyt binding protein essential for lytic viral DNA replication. BZLF1 expression alone can trigger the entire reactivation cascade (1-3).Expression of the BZLF1 gene is tightly controlled at the transcriptional level. The BZLF1 promoter (Zp) normally exhibits low basal activity and is activated in response to TPA or the other reagents described above. The minimal sequence of Zp necessary for activation by the inducers is 233 bp in length (4). The region harbors at least three types of cis regulatory elements, referred to as ZI, ZII, and ZIII. Four copies of the ZI element (ZIA-D) are distributed within the minimal Zp. The myocyte enhancer factor 2D binds to ZIA, ZIB, and ZID (5), whereas Sp1 or Sp3 can bind to ZIA, ZIC, and ZID (6). A single ZII element is located near TATA, sharing homology with binding sites for the cyclic AMP-response element-binding protein (CREB), activating transcription factor (ATF), and activator protein-1 (AP-1) family transcriptional factors such as JunB and JunD (7,8). Two copies of the ZIII element (ZIII-A and -B) bind to the BZLF1 protein. Previou...

show abstract

Propagation and recovery of intact, infectious Epstein–Barr virus from prokaryotic to human cells

Cited by 433 publications

References 28 publications

The latent membrane protein 1 oncogene modifies B-cell physiology by regulating autophagy

The latent membrane protein 1 oncogene modifies B-cell physiology by regulating autophagy

The BRRF1 Early Gene of Epstein-Barr Virus Encodes a Transcription Factor That Enhances Induction of Lytic Infection by BRLF1

Involvement of Jun Dimerization Protein 2 (JDP2) in the Maintenance of Epstein-Barr Virus Latency

Contact Info

Product

Resources

About