Prospective evaluation of blood concentration of mitochondrial DNA as a marker of toxicity in 157 consecutively recruited untreated or HAART-treated HIV-positive patients

Abstract

Highly active antiretroviral therapy (HAART) can cause mitochondrial toxicity. The concentration of mitochondrial DNA (mtDNA) in peripheral blood cells has been reported to be a marker of this toxicity. However, these observations are controversial and were drawn from small series. Thus, we analysed the value of blood mtDNA as a marker of mitochondrial toxicity in a large cohort of human immunodeficiency virus (HIV)-infected out-patients during routine clinical evaluations. Real-time quantitative PCR was used to determine the mtDNA to nuclear DNA (nDNA) ratio in peripheral blood mononuclear cells from 157 consecutive HIV-1-infected patients (13 naive, 144 receiving HAART) and 30 HIV-1-uninfected patients. The mtDNA to nDNA ratio was significantly lower in both groups of HIV-infected patients than in the control group. No significant difference was observed between treated and naive HIV-infected patients. Lactataemia was significantly lower in controls than in the group of HIV-treated patients. None of the treated patients had lactataemia 45 mmol/l or bicarbonates o20 mmol/l. Triglyceride levels were significantly higher in the HAART-treated patients than in the nontreated patients. Clinical symptoms of lipodystrophy were observed in 62 HAART-treated patients. These symptoms were not associated with an abnormal mtDNA to nDNA ratio or plasma triglyceride concentration. The mtDNA to nDNA ratio was lower in DDI/D4T-treated patients than in AZT/3TC-treated patients. In conclusion, there are no obvious links between the mtDNA to nDNA ratio in peripheral mononuclear cells and any clinical symptoms or lactate level. Thus, the mtDNA to nDNA ratio in leukocytes does not seem to be an accurate marker of mild and/or long-term mitochondrial toxicity.

Mitochondrial dysfunction and human immunodeficiency virus infection

“…35,61,[64][65][66][67][68][69] Five adult studies confirmed the findings of Coté et al, namely that PBL mtDNA levels in ART-naïve HIV-infected patients were depleted vs. HIV-negative control groups but not significantly different from ART-exposed patients, and a single cross-sectional study in South Africa demonstrated the same findings in a paediatric population. 70 However, conflicting findings occurred in the small (n=10) study by Henry et al 64 that demonstrated no difference between HAART-exposed patients and healthy controls, and in the longitudinal study of Miura et al 67 that demonstrated complete amelioration of PBL mtDNA depletion to normal levels with AZT/3TC-based HAART, suggesting that HIV was the major cause of depleted PBL mtDNA.…”

“…71 These data support the notion that HIV itself, and not NRTIs, is the major contributor towards PBL mtDNA depletion. Regarding ART-exposed patients in larger studies, Chiappini et al, 65 Coté et al 68 and De Mendoza et al 66 all found lower levels of PBL mtDNA associated with d4T, DDI and particularly d4T/DDI combination regimens. In the largest of these, a cross-sectional study by Coté et al, 68 of 214 ART-treated individuals exposed to ART for more than four months, clearly demonstrated progressive PBL mtDNA depletion with d4T/ddI, ddI, d4T and AZT combinations, in this order.…”

Exploration of global gene expression in human liver steatosis by high-density oligonucleotide microarray

“…22 In brief, the nuclear gene (TaqMan s b-actin control reagent, Perkin Elmer, Courtaboeuf, France) and the mitochondrial gene MT-CYB (cytochrome b or cyt b) were quantified separately by real-time quantitative PCR. We amplified part of the cyt b mitochondrial gene with specific primers (Table 2).…”

Fate and characterization of circulating tumor cells in a NOD/SCID mouse model of human hepatocellular carcinoma

“…The total DNA obtained was used as a reference to determine whether Mahlavu cells were present in the different tissues. DNA was kept at À801C and mitochondrial DNA (mtDNA) was quantified as previously described (Chiappini et al, 2004). Briefly, we amplified a part of the cyt b mitochondrial gene by use of specific primers, Mito-CytB-F CAACATCTCCGCATGATGAAA and MitoCytB-R CCATAATTTACGTCTCGAGTGATGTG and a specific probe 5 0 -6-Fam-CCATGCACTACTCACCAGACG CCTCAA-3 0 -Tamra.…”