Protein and Antibody Engineering by Phage Display

Abstract

Phage display is an in vitro selection technique that allows for the rapid isolation of proteins with desired properties including increased affinity, specificity, stability, and new enzymatic activity. The power of phage display relies on the phenotype-to-genotype linkage of the protein of interest displayed on the phage surface with the encoding DNA packaged within the phage particle, which allows for selective enrichment of library pools and high-throughput screening of resulting clones. As an in vitro method, the conditions of the binding selection can be tightly controlled. Due to the high-throughput nature, rapidity, and ease of use, phage display is an excellent technological platform for engineering antibody or proteins with enhanced properties. Here, we describe methods for synthesis, selection, and screening of phage libraries with particular emphasis on designing humanizing antibody libraries and combinatorial scanning mutagenesis libraries. We conclude with a brief section on troubleshooting for all stages of the phage display process.

Interrogation of side chain biases for oligomannose recognition by antibody 2G12 via structure-guided phage display libraries

“…To overcome these limitations, we engineered 2G12 (Fab) 2 display sequences into the pHP153 phagemid vector that has been utilized for successful display and library screening of numerous protein and antibody fragments 17–18 . Furthermore, since all required mutations for the 2G12 domain exchange architecture was contained in the (Fab) 2 , we examined both a GCN4 leucine zipper-contaning construct (“pHP153-2G12z”) as well as one containing only the IgG hinge region (“pHP153-2G12h”) (Fig.…”

“…The pHP153 vector was used to display 2G12 (Fab) 2 on the surface of filamentous bacteriophage 17 . The Escherichia coli codon-optimized synthetic genes for 2G12 (light chain with a C-terminal FLAG tag, heavy chain with and without a GCN4 leucine zipper) were obtained from Genewiz (South Plainfield, NJ).…”

“…Oligonucleotide-directed Kunkel mutagenesis was used to incorporate diversity elements using the following primers: Lib1, TGCGGTGTTTCTAACTTC NMC ATC NMCNMCNMCNMC ATGAACTGGGTTCGTCG and ACCGTTTCTCGTGACGAC NMCNMCNMC TTCGTTTACCTGCAGATG; Lib2 TGGGTTGCTTCTATCTCTACCTCTTCCACC NMCNMC GACTATGCTGACGCTGTTAAAG and GCTATCTACTACTGCGCTCGT NMC GGTTCT NMCNMC CTGTCT NMCNMCNMC CCGTTCGACGCTTG 17 . The library DNA was electroporated into SS320 E. coli and library phage amplified according to standard protocols 17 . Briefly, each library was subjected to one round of selection against the anti-FLAG antibody M2 (display selection), or one round against M2 then three rounds against gp120 (functional selection).…”

Biopanning of polypeptides binding to bovine ephemeral fever virus G1 protein from phage display peptide library

“…Phage display, a well-established powerful and popular technology, has been extensively used in many fields, including antibody engineering [16,17], ligand screening [18,19], peptide drug discovery and manufacture [20,21], disease molecular diagnostic analysis [22], biosensing [23] and vaccine research and development [24]. The high capacity and abundance of random phage display library makes it appropriate for high-throughput screening of peptide ligands that specifically bind with the given targets.…”

Exploration of Anti-Yo and Anti-Hu paraneoplastic neurological disorders by PhIP-Seq reveals a highly restricted pattern of antibody epitopes

“…Among these, variations on bacteriophage display technologies have been successfully utilized for decades in antigen discovery, 14 epitope mapping, 15 and antibody engineering. 16 Traditionally, tissue-specific cDNA libraries or degenerate or random synthetic oligonucleotides are cloned and expressed on the surface of phage capsids which are panned against immobilized antibody or other targets of interest. More recently, rationally designed libraries encompassing the entire human proteome have been implemented.…”