Protein expression and transcription profiles of three strains of Aeromonas salmonicida ssp. salmonicida under normal and iron-limited culture conditions

Abstract

BackgroundAeromonas salmonicida is an important fish pathogen that produces a wide and varied array of virulence factors. Here we used iron deprivation by addition of the chelator 2’2-dipyridyl to induce the expression of several such virulence factors in three isolates of Aeromonas salmonicida (one avirulent and two virulent). By using SDS-PAGE followed by mass spectrometry, we identified proteins that appeared differentially expressed under these conditions. The differential transcription of the identified gene products were subsequently measured by reverse transcription quantitative real-time PCR (RT-qPCR).ResultsOur initial screening using SDS-PAGE identified five proteins that appeared differentially expressed in virulent and avirulent isolates or, within the same isolates, between bacteria cultivated under iron-rich or iron-deprived conditions. The transcription of the genes coding for these proteins were subsequently quantified by RT-qPCR. Results of this analysis demonstrated that the gene coding for alkyl hydroperoxide reductase (AhpC), a protein involved in oxidative stress response, was transcribed at a higher rate in the virulent strain as compared to the avirulent strain. Additionally, it was observed that addition of an iron chelator to the culture medium lead to a reduction of the transcription levels of the regulatory histone-like nucleoid structuring protein (H-NS). This was consistent in all three isolates. On the other hand, the transcription levels of the virulence array protein (VapA) and the protein ATP-synthetase F (ATPF) displayed only limited changes, despite being the dominant component of a protein fraction that displayed changes during the preliminary SDS-PAGE screening. This was true regardless of the culture conditions and of the isolates considered. Finally, transcription of the enzyme enolase was upregulated in the iron-deprived broths in all isolates.ConclusionsWe identified several genes differentially expressed under culture conditions known to lead to the overexpression of virulence factors. In addition, we identified alkyl hydroperoxide as being overexpressed in the virulent isolates compared to the avirulent isolates. The results from this study will contribute to enhance our understanding of the virulence of A. salmonicida and may suggest new directions for further research.

Aeromonas salmonicida Growth in Response to Atlantic Salmon Mucins Differs between Epithelial Sites, Is Governed by Sialylated and N -Acetylhexosamine-Containing O -Glycans, and Is Affected by Ca 2+

“…salmonicida A449 ␤-N-acetylhexosaminidase (ASA_RS14095) gene was designed using the Primer 3 software (http://bioinfo .ut.ee/primer3-0.4.0/primer3/) (forward, TGACCGTACCGACTACACCT; reverse, AAGTGGAAGGTCTTGAGC GG). For the 16S reference gene, we used a previously validated primer pair described previously by Menanteau-Ledouble et al (forward, ATATTGCACAATGGGGGAAA; reverse, GTTAGCCGGTGCTTCTTCTG) (52). The primer pairs were used at a final concentration of 250 nM.…”

Antigens of Aeromonas salmonicida subsp. salmonicida specifically induced in vivo in Oncorhynchus mykiss

“…Two inserts were also sequenced that were identical to the ones previously identified (Menanteau-Ledouble et al 2014a;Menanteauledouble et al 2014b). The first was identical to the UDP-3-O-acyl-N-acetylglucosamine and likely originated from the same original insertion event.…”

“…Two inserts were also sequenced that were identical to the ones previously identified (Menanteau‐Ledouble et al . ; Menanteau‐ledouble et al . ).…”

“…Consequently, we have previously applied IVIAT to Aeromonas salmonicida subsp. salmonicida (clinical isolate A14390) infecting rainbow trout weighing an average of 92 grams (Menanteau-Ledouble et al 2014a;Menanteauledouble et al 2014b) in a study approved by the university institutional ethics committee and the national authority according to §26 of the Austrian Law for Animal Experiments (Tierversuchsgesetz 2012-TVG 2012-91 under the No. GZ 68.205/140-II/3b/2012).…”

Use of in vivo induced antigen technology to identify genes from Aeromonas salmonicida subsp. salmonicida that are specifically expressed during infection of the rainbow trout Oncorhynchus mykiss

“…In A. salmonicida , it has been shown that a number of virulence factors were differentially expressed based on environmental conditions. For example, the Flp/Fap pilin proteins [ 24 ], the enzyme enolase [ 25 ] as well as a number of molecules of the iron acquisition apparatus [ 26 ] have all been shown to be upregulated under iron-deprived culture conditions.…”