Pseudomonas aeruginosa NfsB and nitro-CBI-DEI – a promising enzyme/prodrug combination for gene directed enzyme prodrug therapy

Abstract

BackgroundThe nitro-chloromethylbenzindoline prodrug nitro-CBI-DEI appears a promising candidate for the anti-cancer strategy gene-directed enzyme prodrug therapy, based on its ability to be converted to a highly cytotoxic cell-permeable derivative by the nitroreductase NfsB from Escherichia coli. However, relative to some other nitroaromatic prodrugs, nitro-CBI-DEI is a poor substrate for E. coli NfsB. To address this limitation we evaluated other nitroreductase candidates from E. coli and Pseudomonas aeruginosa.FindingsInitial screens of candidate genes in the E. coli reporter strain SOS-R2 identified two additional nitroreductases, E. coli NfsA and P. aeruginosa NfsB, as being more effective activators of nitro-CBI-DEI than E. coli NfsB. In monolayer cytotoxicity assays, human colon carcinoma (HCT-116) cells transfected with P. aeruginosa NfsB were >4.5-fold more sensitive to nitro-CBI-DEI than cells expressing either E. coli enzyme, and 23.5-fold more sensitive than untransfected HCT-116. In three dimensional mixed cell cultures, not only were the P. aeruginosa NfsB expressing cells 540-fold more sensitive to nitro-CBI-DEI than pure cultures of untransfected HCT-116, the activated drug that they generated also displayed an unprecedented local bystander effect.ConclusionWe posit that the discrepancy in the fold-sensitivity to nitro-CBI-DEI between the two and three dimensional cytotoxicity assays stems from loss of activated drug into the media in the monolayer cultures. This emphasises the importance of evaluating high-bystander GDEPT prodrugs in three dimensional models. The high cytotoxicity and bystander effect exhibited by the NfsB_Pa/nitro-CBI-DEI combination suggest that further preclinical development of this GDEPT pairing is warranted.

Progress and problems with the use of suicide genes for targeted cancer therapy

“…In addition, they observed wild type and mutated version of other nitroreductase enzymes such as flavin reductase FRase I from Vibrio Fischeri are able to activate CB1954 and its analogues [106, 111]. In parallel, others have developed new generation of nitroaromatic prodrugs such as nitro-CBI-DEI and PR-104A which can be activated both by hypoxia and bacterial nitroreductases [112]. Under hypoxic conditions (e.g., tumor environment), these two compounds undergo a one-electron transfer reduction reaction by human endogenous oxidoreductases but in normal cells they rapidly get reoxidazed [110].…”

Pseudomonas aeruginosa MdaB and WrbA are water-soluble two-electron quinone oxidoreductases with the potential to defend against oxidative stress

“…With the exception of NfsA (no hit sharing >20% identity across the full amino acid sequence), the best aligned predicted protein sequence from the P. aeruginosa genome was taken forward for further study (PA0949, 39% amino acid identity with WrbA; PA1204, 46% identity with ChrR; PA2580, 55% identity with MdaB; PA4975, 35% identity with NQO1; and PA5190, 25% identity with NfsB; Green et al, 2013). Primers for amplifying and cloning nfsB_ Pa, nqo1_Pa and chrR_Pa into pSX and pET28a + were as described in Prosser et al (2013), and for mdaB_Pa, wrbA_ Pa, and P. aeruginosa katA (PA4236) the following primer sets were used: mdaB_Fw (CCCCATATGAAAAACATTC TCCTGC), mdaB_Rv (CCCGTCGACTCAGCCG GCGC); wrbA_Fw (CCCCATATGTTGAGCAGTCCCTACATCCT), wrbA_Rv (CCCGTCGACTCAACTCCCCAGCTTGCCGG); and katA_Fw (CCCCATATGGAAGAGAAGACCCGCCT), katA_Rv (CCCGCGGCCGCTCAGTCCAGCTTCAGGCC GA) (restriction sites used for cloning are in bold).…”

Identification of novel members of the bacterial azoreductase family in Pseudomonas aeruginosa

“…In contrast paArsH and paMdaB have rates that are approximately 5 and 3 fold faster respectively. This is the first evidence of nitroreductase activity of these enzymes present in P. aeruginosa as a previous study [43] using an indirect readout showed no activity over background during overexpression of these enzymes in cancer cell lines.…”