Purification and Characterization of (2R,3R)-2,3-Butanediol Dehydrogenase of the Human Pathogen Neisseria gonorrhoeae FA1090 Produced in Escherichia coli

Tang, Wanggang; Lian, Chaoqun; Si, Yu; Chang, Jianrong

doi:10.1007/s12033-021-00308-9

Cited by 7 publications

(10 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Currently, studies on 2,3-BD metabolism have focused mainly on biological production, and the 2,3-BD metabolic process in N. gonorrhoeae is largely unknown [3]. The biosynthesis of 2,3-BD in a variety of microorganisms can be regulated by oxygen availability, with a low oxygen supply that promotes 2,3-BD production and upregulation of the expression of enzymes involved in the pathway [40][41][42].…”

Section: Discussionmentioning

confidence: 99%

“…The pET‐28b‐derived expression vector, a previously constructed plasmid pET‐NgBDH (pET‐28b‐derived recombinant plasmid carrying the gene coding for NgBDH), which encodes an N‐terminal His‐tagged wild‐type NgBDH [3], and two Escherichia coli strains (DH5α for vector construction and BL21(DE3) for protein production) were stored in our laboratory. Oligonucleotides for site‐directed mutagenesis were synthesized by Sangon Biotech.…”

Section: Methodsmentioning

confidence: 99%

“…Site‐directed mutagenesis experiments were carried out by the polymerase chain reaction (PCR)‐based overlap extension method [26], using the previously constructed vector pET‐NgBDH [3] as a template. The oligonucleotides used to generate the mutants were as follows: Asn342Ala (forward primer, 5′‐TGATCCACAACGCTGAAAGCGCGGTTAAAATC‐3′, and reverse primer, 5′‐AACCGCGCTTTCAGCGTTGTGGATCAGACGTT‐3′); Phe120Ala (forward primer, 5′‐AAGATATGAACGCTATCGGTCTGGGTGGTTGC‐3′, and reverse primer, 5′‐ACCCAGACCGATAGCGTTCATATCTTTGCTCAG‐3′); Val161Ala (forward primer, 5′‐ ACCGCTGAGCGCGGGTCACCACGCGTACG‐3′, and reverse primer, 5′‐ ACGCGTGGTGACCCGCGCTCAGCGGTTCGATC‐3′); and Val161Thr (forward primer, 5′‐GATCGAACCGCTGAGCACCGGTCACCACGCGTAC‐3′, and reverse primer, 5′‐GTACGCGTGGTGACCGGTGCTCAGCGGTTCGATC‐3′).…”

Section: Methodsmentioning

confidence: 99%

“…2,3-Butanediol dehydrogenases (BDHs), also regarded as acetoin (diacetyl) reductases, catalyze the reversible interconversion between 2,3-butanediol (2,3-BD) and acetoin and/or the formation of acetoin from diacetyl in the presence of either nicotinamide adenine dinucleotide(H) or nicotinamide adenine dinucleotide phosphate (NADP[H]) [1][2][3][4]. These enzymes can be classified into three subfamilies, namely (2 S,3 S)-BDHs (also known as L-BDHs), meso-BDHs, and (2 R,3 R)-BDHs (abbreviated as RR-BDHs, D-BDHs), on the basis of substrate stereospecificity, with 2,3-BD having three optical isomers, (2 R,3 R)-2,3-BD (RR-BD), meso-2,3-BD (meso-BD), and (2 S,3 S)-2,3-BD [3,5]. Interestingly, all the reported (2 S,3 S)-BDHs and meso-BDHs belong to the short-chain dehydrogenase/reductase (SDR) superfamily with ~250 residue subunits, while RR-BDHs fall into the medium-chain dehydrogenase/reductase (MDR) superfamily with ~350-residue subunits [6,7].…”

Section: Introductionmentioning

confidence: 99%

“…Previously, we reported the purification and enzymatic characterization of RR‑BDH from the human pathogen Neisseria gonorrhoeae (NgBDH), a member of the MDR superfamily [3]. In this work, the three‐dimensional structure of this enzyme was modeled and used to determine the substrate binding pattern by molecular docking, which resulted in the identification of two conserved hydrophobic residues, Phe120 and Val161, which are important for substrate binding and catalytic activity.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

The critical role of residues Phe120 and Val161 of (2 R,3 R)‑2,3‑butanediol dehydrogenase from Neisseria gonorrhoeae as probed by molecular docking and site‐directed mutagenesis

Dong,

Zhang,

Gui

et al. 2024

J Basic Microbiol

Self Cite

View full text Add to dashboard Cite

NAD+‐dependent (2 R,3 R)‑2,3‑butanediol dehydrogenase (BDH) from Neisseria gonorrhoeae (NgBDH) is a representative member of the medium‐chain dehydrogenase/reductase (MDR) superfamily. To date, little information is available on the substrate binding sites and catalytic residues of BDHs from this superfamily. In this work, according to molecular docking studies, we found that conserved residues Phe120 and Val161 form strong hydrophobic interactions with both (2 R,3 R)‑2,3‑butanediol (RR‐BD) and meso‐2,3‑butanediol (meso‐BD) and that mutations of these residues to alanine or threonine impair substrate binding. To further evaluate the roles of these two residues, Phe120 and Val161 were mutated to alanine or threonine. Kinetic analysis revealed that, relative to those of wild type, the apparent KM values of the Phe120Ala mutant for RR‐BD and meso‐BD increased 36‐ and 369‐fold, respectively; the catalytic efficiencies of this mutant with RR‐BD and meso‐BD decreased approximately 586‐ and 3528‐fold, respectively; and the apparent KM values of the Val161Ala mutant for RR‐BD and meso‐BD increased 4‐ and 37‐fold, respectively, the catalytic efficiencies of this mutant with RR‐BD and meso‐BD decreased approximately 3‐ and 28‐fold, respectively. Additionally, the Val161Thr mutant slightly decreased catalytic efficiencies (twofold with RR‐BD; 7.3‐fold with meso‐BD) due to an increase in KM (sixfold for RR‐BD; 24‐fold for meso‐BD) and a slight increase (2.8‐fold with RR‐BD; 3.3‐fold with meso‐BD) in kcat. These findings validate the critical roles of Phe120 and Val161 of NgBDH in substrate binding and catalysis. Overall, the current study provides a better understanding of the substrate binding and catalysis of BDHs within the MDR superfamily.

show abstract