qPrimerDepot: a primer database for quantitative real time PCR

Cui, Wenwu; Taub, Dennis D.; Gardner, Kevin

doi:10.1093/nar/gkl767

Cited by 142 publications

(108 citation statements)

References 14 publications

Supporting

Mentioning

107

Contrasting

Order By: Relevance

“…Samples were denatured for 10 s at 95°C, reannealed for 1 min at 60°C, and then denatured again by slowly heating the samples from 60°C to 97°C with a ramp-up rate of 0.11°C/s. Primer pairs were either from qPrimerDepot (27) or designed with the software Primer-BLAST (28) and were cDNA specific. The annealing temperature was always set to approximately 60°C, and the amplicon size range was between 80 and 150 bp.…”

Section: Methodsmentioning

confidence: 99%

Chemokine (C-C Motif) Receptor 1 Is Required for Efficient Recruitment of Neutrophils during Respiratory Infection with Modified Vaccinia Virus Ankara

Price

Luckow

Torres-Domínguez

et al. 2014

J Virol

View full text Add to dashboard Cite

Modified vaccinia virus Ankara (MVA) serves as a versatile platform in vaccine development. This highly attenuated orthopoxvirus, which cannot replicate in mammalian cells, triggers strong innate immune responses, including cell migration. Previously, we have shown that induction of chemokine (C-C motif) ligand 2 (CCL2) by MVA is necessary for the recruitment of monocytes and T cells, but not neutrophils, to the lung. Here, we identified neutrophil-attracting chemokines produced by MVA-infected primary murine lung fibroblasts and murine bone marrow-derived macrophages. We demonstrate that MVA, but not vaccinia virus (VACV) strain WR, induces chemokine expression, which is independent of Toll-like receptor 2 (TLR2) signaling. Additionally, we show that both chemokine (C-C motif) receptor 1 (CCR1) and chemokine (C-X-C motif) receptor 2 (CXCR2) are involved in MVA-induced neutrophil chemotaxis in vitro. Finally, intranasal infection of Ccr1 ؊/؊ mice with MVA, as well as application of the CCR1 antagonist J-113863, revealed a role for CCR1 in leukocyte recruitment, including neutrophils, into the lung.

show abstract

Section: Methodsmentioning

confidence: 99%

Chemokine (C-C Motif) Receptor 1 Is Required for Efficient Recruitment of Neutrophils during Respiratory Infection with Modified Vaccinia Virus Ankara

Price

Luckow

Torres-Domínguez

et al. 2014

J Virol

View full text Add to dashboard Cite

show abstract

“…Relative expression was calculated using the formula 2 Ϫ⌬⌬CT , where ⌬⌬C T ϭ ⌬C T (normalized gene expression at different time points) Ϫ ⌬C T (normalized gene expression at 0 h), expressed as arbitrary units. Primers for each gene were chosen according to the recommendation of the qPrimerDepot database (12). Primer sequences were as follows: mouse IFN-␤, AATTT CTCCAGCACTGGGTG and AGTTGAGGACATCTCCCACG; mouse ISG54, GCAAGATGCACCAAGATGAG and CACTCTCCAGGCAACC TCTT; mouse ISG56, CAAGGCAGGTTTCTGAGGAG and zAAGCAGA TTCTCCATGACCTG; mouse RANTES, CTGCTGCTTTGCCTAC CTCT and CACTTCTTCTCTGGGTTGGC; 18s rRNA, CCTGCGGCTT AATTTGACTC and AACCAGACAAATCGCTCCAC.…”

Section: Methodsmentioning

confidence: 99%

Inhibition of TANK Binding Kinase 1 by Herpes Simplex Virus 1 Facilitates Productive Infection

Jin

Vályi-Nagy

et al. 2012

J Virol

View full text Add to dashboard Cite

The ␥ 1 34.5 protein of herpes simplex viruses (HSV) is essential for viral pathogenesis, where it precludes translational arrest mediated by double-stranded-RNA-dependent protein kinase (PKR). Paradoxically, inhibition of PKR alone is not sufficient for HSV to exhibit viral virulence. Here we report that ␥ 1 34.5 inhibits TANK binding kinase 1 (TBK1) through its amino-terminal sequences, which facilitates viral replication and neuroinvasion. Compared to wild-type virus, the ␥ 1 34.5 mutant lacking the amino terminus induces stronger antiviral immunity. This parallels a defect of ␥ 1 34.5 for interacting with TBK1 and reducing phosphorylation of interferon (IFN) regulatory factor 3. This activity is independent of PKR. Although resistant to IFN treatment, the ␥ 1 34.5 amino-terminal deletion mutant replicates at an intermediate level between replication of wild-type virus and that of the ␥ 1 34.5 null mutant in TBK1 ؉/؉ cells. However, such impaired viral growth is not observed in TBK1 ؊/؊ cells, indicating that the interaction of ␥ 1 34.5 with TBK1 dictates HSV infection. Upon corneal infection, this mutant replicates transiently but barely invades the trigeminal ganglia or brain, which is a difference from wild-type virus and the ␥ 1 34.5 null mutant. Therefore, in addition to PKR, ␥ 1 34.5 negatively regulates TBK1, which contributes viral replication and spread in vivo.

show abstract

“…Most primer pair sequences for quantitative PCR were obtained from the mouse qPrimerDepot data base (supplemental Table S1) (20). Initial RNA concentrations were calculated by linear regression using LinReg v. 9.16 software (21).…”

Section: Methodsmentioning

confidence: 99%

Activation of Cyclic AMP Signaling in Ae2-deficient Mouse Fibroblasts

Mardones

Medina

Elferink

2008

Journal of Biological Chemistry

View full text Add to dashboard Cite

Anion exchanger 2 (AE2, SLC4A2) is a ubiquitously expressed membrane solute carrier that regulates intracellular pH (pH i ) by exchanging cytosolic bicarbonate for extracellular chloride. We used fibroblasts from Ae2-deficient (Ae2 a,b ؊/؊ ) mice to study the effects of an alkaline shift in resting intracellular pH (pH i ) on the activation of cAMP signaling and gene expression. Fluctuations of intracellular and extracellular pH are among the most frequent challenges that living cells must overcome during their life span. The first line of defense against potentially harmful pH i changes, apart from the limited buffering capacity of the cytosol, is comprised of several electrolyte transporter proteins in the plasma membrane, which can import or export acid-base equivalents in a pH i -dependent manner (1). Among these, the sodium-independent anion exchanger family of transporters (AE, SLC4A1-3) mediates the extrusion of base equivalents in the form of bicarbonate, coupled with the electroneutral import of chloride (2). In particular, AE2 (SLC4A2) is considered to be a housekeeping regulator of pH i , because of its broad pattern of expression (3, 4), combined with the ability to respond to intracellular alkalization by increasing its transport activity (5). These properties distinguish AE2 from the closely related transporters AE1 and AE3. AE1 (SLC4A1) expression is highly restricted to the erythroid cell lineage and acid-secreting cells in the kidney, and its activity is not regulated by pH. AE3 (SLC4A3) is mostly expressed in excitable cells from cardiac and neural tissue.The intrinsic pH-sensing properties of most acid-base transporters allow for rapid cellular adaptation to transient pH i changes. Chronic pH i or pH o changes, on the other hand, may trigger alternative long term responses as to maintain pH i homeostasis or adapt to a new pH i set point. Even though changes in gene expression in response to acid and/or alkaline challenges in several cell types have been reported (6, 7), the signaling pathways and molecular targets leading to these adaptive responses remain largely unknown.It has been proposed that soluble adenylyl cyclase (sAC), 2 a distinct form of adenylyl cyclase activated by bicarbonate could function as both a metabolic and a pH i sensor (8). sAC is insensitive to G-protein-coupled receptors and is therefore fundamentally different from the membrane-bound adenylate cyclases. In this way, sAC would constitute a second line of response to pH i disturbances, one that could have an impact on cell signaling, protein trafficking, and gene expression (8 -10). sAC is abundantly expressed in male germ cells, where it plays an essential role in bicarbonate-mediated spermatozoa maturation and capacitation (11,12). sAC expression has also been detected in many other tissues and cell lines of both murine and human origin (13,14). Because of its bicarbonate responsiveness, sAC appears as a suitable candidate for initiating at least part of a cAMP-dependent component of pH i regulation (15). If so, it w...

show abstract

qPrimerDepot: a primer database for quantitative real time PCR

Cited by 142 publications

References 14 publications

Chemokine (C-C Motif) Receptor 1 Is Required for Efficient Recruitment of Neutrophils during Respiratory Infection with Modified Vaccinia Virus Ankara

Chemokine (C-C Motif) Receptor 1 Is Required for Efficient Recruitment of Neutrophils during Respiratory Infection with Modified Vaccinia Virus Ankara

Inhibition of TANK Binding Kinase 1 by Herpes Simplex Virus 1 Facilitates Productive Infection

Activation of Cyclic AMP Signaling in Ae2-deficient Mouse Fibroblasts

Contact Info

Product

Resources

About