Quantification of Epstein–Barr virus <scp>DNA</scp> load in nasopharyngeal brushing samples in the diagnosis of nasopharyngeal carcinoma in southern China

Zheng, Xiaojing; Lu, Li Xia; Li, Xi Zhao; Jia, Wei Hua

doi:10.1111/cas.12718

Cited by 59 publications

(79 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…By enhancing transmission of the virus from cell to cell, EBV lytic infection may increase the total number of latently-infected cells and thus is an essential aspect of viral pathogenesis. A small subset of lytically-infected cells is commonly detected in biopsies of EBV-associated malignancies 91-93, suggesting a potential role for viral lytic infection in promoting tumor growth in vivo . Furthermore, some studies indicated that the viral lytic cycle in a fraction of B cells promotes the transformation of B-lymphocytes in vitro 94 and growth of B cell lymphoma in vivo 7,95 through the release of paracrine growth factors and angiogenic factors.…”

Section: The Pathogenic Role Of Lytic Infection In Ebv-associatedmentioning

confidence: 99%

Epstein-Barr virus lytic reactivation regulation and its pathogenic role in carcinogenesis

Li¹,

Liu²,

Hu³

et al. 2016

Int. J. Biol. Sci.

106

111

View full text Add to dashboard Cite

Epstein-Barr virus (EBV) has been associated with several types of human cancers. In the host, EBV can establish two alternative modes of life cycle, known as latent or lytic and the switch from latency to the lytic cycle is known as EBV reactivation. Although EBV in cancer cells is found mostly in latency, a small number of lytically-infected cells promote carcinogenesis through the release of growth factors and oncogenic cytokines. This review focuses on the mechanisms by which EBV reactivation is controlled by cellular and viral factors, and discusses how EBV lytic infection contributes to human malignancies.

show abstract

Section: The Pathogenic Role Of Lytic Infection In Ebv-associatedmentioning

confidence: 99%

Epstein-Barr virus lytic reactivation regulation and its pathogenic role in carcinogenesis

Li¹,

Liu²,

Hu³

et al. 2016

Int. J. Biol. Sci.

106

111

View full text Add to dashboard Cite

show abstract

“…A repetitive highly conserved BamHI-W targets was used to quantify EBV DNA copy number by quantitative real-time PCR. 25,26 EBV sequence was acquired from the GenBank database (accession number V01555). The qPCR system is consisted of the amplification primers: BW-F, 5-CCCAACACTCCACCACACC-3; BW-R, 5-TCTTAGGAGCTGTCCGAGGG-3; and a dual-labeled fluorescent TaqMan probe: BW-probe, 5-(FAM)CACA CACTACACACACCCACCCGTCTC(TAMRA)-3.…”

Section: Detection Of Ebv Dna Copy Number By Quantitative Real-timementioning

confidence: 99%

Decreased oral Epstein‐Barr virus DNA loads in patients with nasopharyngeal carcinoma in Southern China: A case‐control and a family‐based study

Xue

Liao

et al. 2018

Cancer Medicine

Self Cite

View full text Add to dashboard Cite

The link of nasopharyngeal carcinoma (NPC) with Epstein‐Barr virus (EBV) has been established for decades. Although an abnormal high level of EBV sero‐antibody spectrum and cell‐free circulating EBV DNA loads were exhibited in NPC patients, oral EBV DNA loads, which are primarily responsible for the EBV transmission, has not been previously studied in NPC patients. We conducted an epidemiological study to measure the oral EBV loads, viral components, and the relationship with the serum antibody titers in a large case‐control population (968 cases and 1656 controls) and a family‐based population (91 cases and 165 unaffected family members). EBV DNA loads were detected by quantitative PCR approach targeting the BamHI‐W region. Although a large individualized variation existed, we still observed a decreased oral EBV DNA loads in the population of NPC patients compared to that of healthy controls (ORs were 1.00, 0.69, 0.62, 0.33 classified by the quartiles of viral loads, P trend < .001) and family members. In contrast, the elevated levels of oral EBV loads were present in asymptomatic males and elders, suggesting a different important source for EBV transmission. Notably, oral EBV loads were inversely associated with serum antibody titers of VCA‐IgA, EA‐IgA (All P trend < .001) in the cases but not in the controls. Our study provides the first epidemiological data of oral EBV loads and viral components in NPC patients and controls in the highest risk area of Southern China, indicating that NPC status is unlikely to be an important determinant of EBV transmission.

show abstract

“…Molecular analysis of minimally invasive NP brushings that contain abnormal level of viral DNA and RNA provides an alternative and promising new approach for (early) NPC diagnosis . The presence of latently EBV‐infected NPC tumor cells in NP brush specimens can be visualized by cytology .…”

mentioning

confidence: 99%

Epstein‐Barr virus mRNA profiles and viral DNA methylation status in nasopharyngeal brushings from nasopharyngeal carcinoma patients reflect tumor origin

Ramayanti

Juwana

Verkuijlen

et al. 2016

Intl Journal of Cancer

View full text Add to dashboard Cite

Undifferentiated nasopharyngeal carcinoma (NPC) is 100% associated with Epstein‐Barr virus (EBV) as oncogenic driver. NPC is often diagnosed late due to initial vague complaints and obscured location. Prior studies suggest that measurement of EBV DNA load and RNA transcripts in nasopharyngeal (NP) brushings is useful for minimally invasive NPC diagnosis. However, whether these EBV markers relate to local virus replication or reflect tumor origin remains to be demonstrated. To resolve this, we analysed EBV‐DNA characteristics and quantified latent and lytic viral RNA transcripts in NP brushings and matching frozen NP‐biopsy specimens from patients suspected of having NPC.We observed non‐fragmented and Cp‐promotor methylated EBV‐DNA in both NP brushings and biopsies suggestive of tumor origin. Using quantitative RT‐PCR we determined expression levels of 7 critical latent (EBER1, Qp‐EBNA1, EBNA2, BART, LMP1, LMP2, BARF1) and 5 lytic (Zta, Rta, TK, PK and VCA‐p18) RNA transcripts. Although latent and early lytic RNA transcripts were frequently detected in conjunction with high EBV viral load, in both brushings and biopsies the latent transcripts prevailed and reflected a typical NPC‐associated latency‐II transcription profile without EBNA2. Late lytic RNA transcripts were rare and detected at low levels mainly in NP brushings, suggestive of abortive viral reactivation rather than complete virus replication. EBV‐IgA serology (EBNA1, VCA, Zta) did not correlate to the level of viral reactivation in situ.Overall, viral RNA profiling, DNA fragmentation and methylation analysis in NP brushings and parallel biopsies indicate that NP brush sampling provides a true and robust indicator of NPC tumor presence.

show abstract

Quantification of Epstein–Barr virus DNA load in nasopharyngeal brushing samples in the diagnosis of nasopharyngeal carcinoma in southern China

Cited by 59 publications

References 17 publications

Epstein-Barr virus lytic reactivation regulation and its pathogenic role in carcinogenesis

Epstein-Barr virus lytic reactivation regulation and its pathogenic role in carcinogenesis

Decreased oral Epstein‐Barr virus DNA loads in patients with nasopharyngeal carcinoma in Southern China: A case‐control and a family‐based study

Epstein‐Barr virus mRNA profiles and viral DNA methylation status in nasopharyngeal brushings from nasopharyngeal carcinoma patients reflect tumor origin

Contact Info

Product

Resources

About