Quantification of human cytomegalovirus DNA using the polymerase chain reaction

Fox, Jayne C.; Griffiths, Paul; Emery, Vincent

doi:10.1099/0022-1317-73-9-2405

Cited by 119 publications

(56 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As an alternative way to discriminate amplified target sequences from st sequences, recognition sites of a restriction enzyme or a DNA-binding protein present either in the st or the target sequence may be used (Fox et al, 1992;Lundeberg et al, 1991;Stieger et al, 1991). Without the use of labelled probes in post-PCR detection steps, however, formation of heteroduplexes between st and st amplimers during PCR may lead to significant errors (Becker-Andr~ & Hahlbrock, 1989).…”

Section: Discussionmentioning

confidence: 99%

“…In addition, determination of the amount of viral target sequences should permit better monitoring of disease progression and of antiviral therapies (Einsele et al, 1991). Presently, only limited data have been reported on the quantitative or semiquantitative determination of HCMV copy numbers in clinical samples (Fox et al, 1992;Shibata et al, 1992;Cagle et al, 1992). 5"GCGAATTCGGAAACGATGGTGTAGTTCG 3' 5"CGGAAACGATGGTGTAGTTCG 3" 5" GTCAAGGATCAGTGGCACAGC 3' 5" GTAGCTGGCATTGCGATTGGT 3' 5"ACCCGTGGAGACTGCAAAAAAATG 3' 5"CATTTTTTTGCAGTCTCCACGGGT 3' 5'CCGGATCCCGCCGCCCGCCCCGCGCCCGCCGCGGCAGCACCTGGCT 3' 5'GCGAATTCGTAAACCACATCACCCGTGGA 3' 5'GCGAATTCGTAAACCACATCACCCGTGGAGACTGC 3'…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Quantitative determination of human cytomegalovirus target sequences in peripheral blood leukocytes by nested polymerase chain reaction and temperature gradient gel electrophoresis

Schäfer

Braun

Möhring

et al. 1993

Journal of General Virology

View full text Add to dashboard Cite

A competitive nested PCR-temperature gradient gel electrophoresis protocol (nPCR/TGGE) has been established for the quantification of human cytomegalovirus (HCMV) target sequences. The measurement was achieved by co-amplification of a defined copy number of an internal standard (st) and separation of st and wildtype (wt) amplimers by temperature gradient gel electrophoresis (TGGE). The number of HCMV target sequences could be precisely determined within wt/st ratios of 0.1 to 10. With 50 copies of the st sequence the detection limit of nPCR/TGGE was found to be five to l0 copies of the target sequence. Effects of sample preparation on quantitative HCMV PCR were minimized by the additional quantification offl-globin target sequences and calculation of the ratio of HCMV copies/fl-globin copies. Serial peripheral blood leukocyte specimens of 17 renal allograft recipients positive in a qualitative nested HCMV PCR were tested using nPCR/TGGE. Thirty healthy blood donors served as negative controls. Positive results were obtained by nPCR/TGGE in nine renal allograft recipients but in none of the healthy blood donors. Five of five patients with an HCMV pp65 antigenaemia and positive for HCMV IgM were positive in nPCR/TGGE. The highest HCMV/fl-globin ratios (10000 to 8000 copies HCMV/ 106 copies fl-globin) were found in transplant recipients experiencing acute clinically symptomatic HCMV infection. HCMV DNA levels in asymptomatic patients ranged from 900 to 200 copies HCMV/10 ~ fl-globin.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Quantitative determination of human cytomegalovirus target sequences in peripheral blood leukocytes by nested polymerase chain reaction and temperature gradient gel electrophoresis

Schäfer

Braun

Möhring

et al. 1993

Journal of General Virology

View full text Add to dashboard Cite

show abstract

“…32 Briefly, 5 l of DNA extract was co-amplified together with a known copy number (between 50 and 10 000 copies), of control DNA (a 149 bp CMVsequence from AD169, which had been mutated to produce a unique restriction site for Hpa1 32 ). Reaction conditions were as described for the qPCR, except for the addition of 3 ng of 5′-32 P-labelled gB2 primer (100 kBq).…”

Section: Quantitative Competitive Pcr (Qcpcr)mentioning

confidence: 99%

Longitudinal fluctuations in cytomegalovirus load in bone marrow transplant patients: relationship between peak virus load, donor/recipient serostatus, acute GVHD and CMV disease

Gor

Sabin

Prentice

et al. 1998

Bone Marrow Transplant

170

119

View full text Add to dashboard Cite

Summary:Quantitative competitive PCR was used to monitor the quantity of cytomegalovirus (HCMV) in 1647 blood samples from 110 BMT recipients. DNAemia was detected in 49/110 (45%) of the patients, of whom 15/49 experienced HCMV disease. Peak virus load during surveillance was elevated in symptomatic (median 4.5 log 10 genomes/ml) vs asymptomatic patients (median 3.6 log 10 genomes/ml, P = 0.002) and was also significantly elevated in HCMV seropositive recipients of seronegative marrow, (R+D−, median 5.0 log 10 ), compared to those in the R−D− and R+D+ groups (P Ͻ 0.01 and Ͻ0.005). Odds ratios for disease per 0.25 log 10 increase in viral load, recipient seropositivity and aGVHD were 1.43 (P = 0.004), 6.60 (P = 0.05) and 3.17 (P = 0.08), respectively. In multivariate logistic regression analysis only elevated viral load remained a significant risk factor for HCMV disease. The computed disease probability viral load curve showed a rapid increase in disease risk at viral loads between 3.8 and 5.5 log 10 genomes/ml in blood, and odds ratios for disease were determined for different threshold viral loads. These data demonstrate the central role of viral load in the pathogenesis of HCMV in BMT recipients and provide an additional marker for targeting and monitoring therapy.

show abstract

“…In these cases, peak of ALT was taken as the day of disease. Viral load for HCMV was measured using a quantitative-competitive PCR method on the DNA extracted from the whole blood (level of sensitivity: 200 genomes ml K1 blood) described extensively elsewhere (Fox et al 1992(Fox et al , 1995. The total number of viral load measurements used in the analysis was 388.…”

Section: Methodsmentioning

confidence: 99%

Modelling cytomegalovirus replication patterns in the human host: factors important for pathogenesis

et al. 2006

View full text Add to dashboard Cite

Human cytomegalovirus can cause a diverse range of diseases in different immunocompromised hosts. The pathogenic mechanisms underlying these diseases have not been fully elucidated, though the maximal viral load during infection is strongly correlated with the disease. However, concentrating on single viral load measures during infection ignores valuable information contained during the entire replication history up to the onset of disease. We use a statistical model that allows all viral load data sampled during infection to be analysed, and have applied it to four immunocompromised groups exhibiting five distinct cytomegalovirus-related diseases. The results show that for all diseases, peaks in viral load contribute less to disease progression than phases of low virus load with equal amount of viral turnover. The model accurately predicted the time of disease onset for fever, gastrointestinal disease and pneumonitis but not for hepatitis and retinitis, implying that other factors may be involved in the pathology of these diseases.

show abstract

Quantification of human cytomegalovirus DNA using the polymerase chain reaction

Cited by 119 publications

References 15 publications

Quantitative determination of human cytomegalovirus target sequences in peripheral blood leukocytes by nested polymerase chain reaction and temperature gradient gel electrophoresis

Quantitative determination of human cytomegalovirus target sequences in peripheral blood leukocytes by nested polymerase chain reaction and temperature gradient gel electrophoresis

Longitudinal fluctuations in cytomegalovirus load in bone marrow transplant patients: relationship between peak virus load, donor/recipient serostatus, acute GVHD and CMV disease

Modelling cytomegalovirus replication patterns in the human host: factors important for pathogenesis

Contact Info

Product

Resources

About