Quantification of Rabies Virus by Real Time PCR in comparison with Mouse Inoculation Test (MIT) and Fluorescent Antibody Test (FAT)

Abstract

Real time PCR is the modern molecular techniques used for detection and quantification of viral particle in the specimens. In this study Real Time PCR (RT-PCR) based method was developed and used to quantify the rabies virus PV-11 strains in the different viral harvests of tissue culture fluid in comparison with the Mouse Inoculation Test (MIT) and Fluorescent Antibody Test (FAT). The Eagle's MEM tissue culture medium with 5% fetal calf serum, 1% neomycin and 0.5% Amphotericin-B were used for the propagation of Vero cells in 150 cm 2 tissue culture flasks. The confluent monolayers of the Vero cells (90%) were infected with 0.2 MOI of PV-11 strain of rabies virus. Five individual viral harvests were collected from the infected vero cells at every 3 days interval and subjected for MIT, FAT to quantify the viral titre. The MIT titrated sample was used for the preparation of five point internal reference standard for RT-PCR technique to quantify the number of viral particles in the harvested fluid. The primers targeting 98 base pairs from 446 to 543 in the cDNA of the rabies virus nucleoprotein gene (N gene) were designed and synthesized for Real time PCR assay. The in-house RT-PCR assay was developed with SYBR green master mix. Viral particle in each harvests were quantified in comparison with internal reference standard included in the assay. The results of MIT, FAT and Real time PCR methods were compared with each other. The standardized Real time PCR method was applied for the quantification of viral titre in the different viral harvests cultured using Roller bottle and Bioreactor culturing methods using two different medium. Maximum log of 7.216 viruses per 1 ml of bioreactor viral harvest was quantified by using the real time PCR method. Dilution of the samples are required if the sample having higher viral titre which is not covered within the linear standard range of log 4.50 to log 6.50. This real time PCR based quantification of rabies virus has the advantage of greater accuracy, rapid, economical when compared to the other tests and no animal models required.

Standardization of microcarrier based bioreactor culture in parallel with roller bottle for rabies virus (PV-11) propagation in Vero cell using MEM eagle’s and RPMI 1640 medium

“…The cDNA were subjected to real time PCR amplification with ATGGAACTGACAAGAGACCC (forward), GTGCTTTGCCCGGATATTTT (reveres) primers pairs using SYBR green master mix in 20µ reaction volume. The viral titre in each harvests were quantified in comparison with quantitative standard included in every assay [11].…”

<i>In vitro</i> methods for rabies virus detection, and evaluation of their use in the production of rabies immunoglobulin

“…Указанные особенности явились основанием для применения ОТ-ПЦР-РВ в производстве антирабических препаратов, в частности, для количественной оценки содержания антигена в материале для иммунизации продуцентов антирабической сыворотки 15 . Неоднократно отмечено использование ОТ-ПЦР-РВ в комплексе с методами иммунофлуоресценции для оценки полноты инактивации вируса при изготовлении вакцин [57][58][59].…”