Quercetin shows anti‐tumor effect in hepatocellular carcinoma LM3 cells by abrogating JAK2/STAT3 signaling pathway

Abstract

Objective Hepatocellular carcinima is one of the most common tumors in clinic and also one of the leading causes of death from cancer worldwide. Quercetin shows significant effects on blocking the development of various cancers. Methods We used the human hepatocellular carcinoma LM3 and nude mice tumor model to assess the effects of quercetin in hepatocellular carcinoma and clarify its mechanism of action. We collected LM3 cell line treated with different doses of quercetin at different time periods and determined the vital indexes. The liver tissues of mice were collected and used for western boltting (WB), Hematoxylin and Eosin (H&E) and TUNEL staining. Results Results indicated that quercetin suppressed the Hepatocellular carcinoma (HCC) growth both in vivo and in vitro. Quercetin could disturb LM3 cells proliferation and cell cycle distribution, thus inducing apoptosis. At the same time, quercetin inhibited LM3 cells migration and invasion and promoted HCC autophagy. These effects at least partly depended on the down‐regulation of the activation of JAK2 and STAT3 by quercetin. Conclusion Quercetin inhibited hepatocellular carcinoma progression by modulating cell apoptosis, migration, invasion, and autophagy; and its effects were at least partly related with the JAK2/STAT3 signaling pathway.

Single-nucleus RNA-seq identifies Huntington disease astrocyte states

“…Whitney U test. The GFAP primers were AGGTCC ATGTGGAGCTTGAC (forward) and GCCATTGCCT CATACTGCGT (reverse) and ACTNB primers were CTGGAACGGTGAAGGTGACA (forward) and AAGG GACTTCCTGTAACAATGCA (reverse) [62].…”

Antitumor Effects of Quercetin in Hepatocarcinoma In Vitro and In Vivo Models: A Systematic Review

“…Quercetin antitumor effects have been described in different cancer types, including HCC [1]. In 25 of the articles included in the present review, quercetin efficacy as single treatment was evaluated employing different HCC study models [22][23][24][25][26][27][28][29][30][31][32][33][34][35][36][37][38]46,48,49,[51][52][53][54]57]. Antiproliferative effect of this flavonoid alone has been demonstrated in several researches with in vitro models [22][23][24][25][26][27][30][31][32][33]35,38,46,48,49,[51][52][53][54], highlighting the HepG2 cell line as the most used in 21 of the 25 articles [24,25,<...>…”

“…This ability to reverse glycolytic metabolism of liver cancer cells is often related to the efficacy of antitumor drugs such as quercetin [61]. Furthermore, it has been described that quercetin-derived inhibition of liver cancer cell growth could be mediated by the disruption of different pathways, including protein kinase B (Akt)/mammalian target of rapamycin (mTOR) [23,24], mitogen-activated protein kinase kinase 1 (MEK1)/extracellular signal-regulated kinase 1/2 (ERK1/2) [27,38] and Janus kinase 2 (JAK2)/signal transducer and activator of transcription 3 (STAT3) signaling routes [22]. Induction of p53 as consequence of phosphatidyl inositol 3 kinase (PI3K) and protein kinase C (PKC) downregulation was also linked to antiproliferative effects in liver tumor cells [31], in addition to the blockade of Src homology domain 2 containing tyrosine phosphatase-1/2 (SHP-1/2) activity through directly interacting with quercetin [48].…”

“…Otherwise, though cell cycle regulation is a common mechanism found to be altered in HCC cells, only eight publications have evaluated the effects of quercetin in this process, showing contradictory results [22,25,30,33,49,[51][52][53]. Jeon et al reported an increase in p53 levels and a decrease in cyclin A and checkpoint kinase 1 (CHK1) expression in HepG2 cells after quercetin treatment [25], while this drug downregulated p53 and enhanced G0/G1 and G2/M populations in HepG2 and HuH7 HCC lines [51].…”

Quercetin radiosensitizes non‐small cell lung cancer cells through the regulation of miR‐16‐5p/WEE1 axis

“…Quercetin is a biologically active plant flavonoid with anti‐tumor activities . For instance, quercetin‐3‐methyl ether exerts an inhibitory effect on the development of esophageal cancer via targeting the AKT/mTOR/p70S6K and MAPK signaling pathways; quercetin impedes the proliferation of hepatoma cells and induces their apoptosis via repressing the JAK2/STAT3 signaling pathway; in osteosarcoma, quercetin inhibits the proliferation and metastasis of tumor cells via suppressing the expression of parathyroid hormone receptor 1 . Moreover, quercetin enhances the radiosensitivity of tumor cells via modulating the expression of ATM kinase .…”