Quickly And Simply Detection For Coronavirus Including SARS-CoV-2 On The Mobile Real-Time PCR Device And Without RNA Extraction

Muraoka, Masaaki; Tanoi, Yukiko; Tada, Tetsutaro; Mizukoshi, Mikio; Kawaguchi, Osamu

doi:10.1101/2020.08.06.20168294

Cited by 5 publications

(6 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In this work, we had main objects to construct new methods for detection against each organism included in STIs by real-time PCR without extraction, concentration and purification of DNA from each sample, and moreover, to assess whether it was quick and simple to judge. Therefore, as previously reported [13], taking account of quickness and easiness, PCR in all of trials this time were performed with mobile real-time PCR device PCR1100 device. Simultaneously, KAPA3G Plant PCR Kit was utilized as the real-time PCR reagent of all trials in this since it was showed the most adequate for the PCR1100 device in all current commercial enzyme kits.…”

Section: Discussionmentioning

confidence: 99%

“…As previously reported [13], taking account of quickness and easiness, PCR in all of this trials were performed with mobile real-time PCR device PCR1100 (Nippon Sheet Glass Co. Ltd., Japan). KAPA3G Plant PCR Kit (Kapa Biosystems, Inc., United States) was utilized as the real-time PCR reagent of all trials in this, which it was showed the most adequate in all current commercial enzyme kits when preliminary comparative trials performed for the PCR1100 device (data not shown).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Direct detection of microorganisms responsible for the sexually transmitted infection on the mobile real-time PCR device without treating in advance

Muraoka¹,

K²,

Kawaguchi³

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

As WHO reported, four curable STIs-chlamydia, gonorrhoea, syphilis and trichomoniasis occur more than 1 million per each day globally almond 2016. For this reason, it is important to control these STIs, one of which is ″to detect″. The general methods in order to detect STIs are nucleic acid amplification tests (NAATs). One of the reasons why NAATs are utilized in many tests is that it is possibly to be more sensitive than other test. However, there needs to treat extraction of nucleic acids in advance and amplify specific regions by NAATs, and hence it must take much labour and much time. In this work, for Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Treponema pallidum (TP) which is each etiological agent of chlamydia, gonorrhoea and syphilis, we evaluate and propose ″quicker and simpler″ NAATs. Specifically, utilizing mobile real-time PCR device ″PCR1100″ and PCR reagent kit ″KAPA3G Plant PCR Kit″, it was considered whether real-time direct PCR could be performed or not without treating DNA extraction in advance so-called ″direct″. As a result, firstly, we established that real-time direct PCR could be performed in all of CT, NG, and TP, and moreover, each Ct value correlated with the concentration of each organism similarly to detection of genome DNA (each correlation coefficient R2 > 0.95). Moreover, each assay demonstrated a limit of detection (LOD) of the follows; CT was 10^0.86 = 7.24 IFU/reaction, NG was 10^-0.19 = 0.65 CFU/reaction, and TP was 10^1.4 = 25.1 organisms/reaction. However, it appeared the sensitivity was a little low, especially for CT and TP. Secondly, we found that even as without treating sample in advance, the time of detection was required more less 15 minutes at any of case, which was very quick compared with other current methods for real-time PCR. Additionally, compared with other commercial devices, it was easier to operate the PCR1100 device, for example, start, analysis of Ct value. In conclusion, the present study has demonstrated that it is possible for real-time direct PCR to perform with combination of the PCR1100 device and the PCR reagent kit in 3 kinds of microorganisms-CT, NG and TP. Furthermore, we propose ″quicker and simpler″ methods for NAATs, which it would not take labour and time. Further studies are needed in order to contribute to control STIs.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Direct detection of microorganisms responsible for the sexually transmitted infection on the mobile real-time PCR device without treating in advance

Muraoka¹,

K²,

Kawaguchi³

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…In this work, we had main objects to construct new methods for detection of DENVs by real-time RT-PCR without extraction, concentration and purification of RNA from each mosquito sample, and to assess whether it was possible to quickly and simply judge results. Therefore, referenced the method as previously reported [18], this time such the same, it utilized to be combined the mobile real-time PCR device PCR1100 (Nippon Sheet Glass Co. Ltd.) with one step RT-PCR reagent (THUNDERBIRD Probe One-step qRT-PCR Kit [TOYOBO Co. Ltd.]) this time too.…”

Section: Discussionmentioning

confidence: 99%

“…As previously reported [18], RT and PCR were carrying out in the one-step with using mobile real-time PCR device PCR1100 (Nippon Sheet Glass Co. Ltd., Japan) and one step RT-PCR reagent (THUNDERBIRD® Probe One-step qRT-PCR Kit, TOYOBO Co. Ltd., Japan) for all tests of this study. Briefly describe the composition of RT-PCR reagent, modified as previously reported [18], 1 μL of a sample (positive control RNA, extracted RNA samples or mosquito samples) was amplified in a 16 μL reaction solution containing 1x Reaction Buffer, 1.0 μL of RT Enzyme Mix, 1.0 μL of DNA Polymerase (THUNDERBIRD® Probe One-step qRT-PCR Kit), 0.5 μL of primer / probe mix for targeting all four DENV serotypes (LightMix® Modular Dengue Virus) and 0.3 μM probe (sequence: AGACGCAATACCGCGAGGTG) double-labelled (FAM labelled at 5’end, BHQ® [Black Hole Quencher®, Biosearch Technologies, Inc., USA] labelled at 3’end) for movement of PCR1100. With preliminary tested, each composition was optimized (data not shown).…”

Section: Methodsmentioning

confidence: 99%

Direct detection of Dengue viruses without extraction of RNA on the mobile real-time PCR device

Muraoka

Tanoi

Tada

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Dengue virus (DENV) is the cause of dengue / severe dengue and a virus of the Flaviviridae family, furthermore, dengue fever has rapidly spread in the world in recent decades. DENV is transmitted by female mosquitoes, mainly of the specie Aedes aegypti. The main method to control or prevent the transmission of DENV is to combat the mosquito vectors. Among these, one of important methods is to monitor the DENVs in the mosquito vectors. For the detection of DENV, nucleic acid amplification tests (NAAT) were recommended, of which criterion standard is real-time RT-PCR with highly sensitive and specific. However, it takes long time as to judge the result per a reaction, besides the necessity of the treatment of RNA in advance, example of extraction, concentration and purification. It was our object in this time to develop the method of real-time RT-PCR detecting DENVs in shorter time, moreover without especial treatment of RNA from the mosquito in advance. Besides, this work was performed with combing the mobile real-time PCR device with the one-step RT-PCR reagent. Firstly, we succeeded in shortening the time of real-time RT-PCR for the detection of DENV per one reaction, so that the judgement needed less than 20 minutes if genomic RNA treated in advance. Moreover, each value on the real-PCR device was quantitatively correlated with the positive control RNA from 1.0 x 10 ^ 3 copies to 1.0 x 10 ^ 0 copies per reaction (This correlation coefficient R2 > 0.95). Additionally, it made sure that this method could be applied to each DENV serotype. Secondly, we established the basis of procedure for the real-time RT-PCR without the treatment in advance so-called "direct". As the result that the positive control RNA additive was utilized instead of the real DENV, spiked into the mosquito homogenized and sampled the supernatant without treatment, it was possible to detect on the real-time RT-PCR even if mosquitoes immediately after blood-feeding. For this reason, this method might be able to utilize in human sera, too. According to the results of this work, we could suggest the method is possible to detect DENV more quickly and more simply than heretofore. The Real-time "direct" RT-PCR, especially, could be performed with mobile real-time PCR PCR1100 device and one step RT-PCR reagent only. This method must help to detect some viruses other than DENV, too.

show abstract

“…We thank volunteers participated to offer saliva, Dr. Kazuya Shirato and Dr. Tsutomu Kageyama at NIID for positive control, and Takashi Fukuzawa in an ex-employee at Nippon Sheet Glass Co. Ltd. for technical comments. Furthermore, this journal is based by own preprint, which we have registered with medRxiv [31], so that we thank medRxiv for the opportunity to submit as the preprint.…”

Section: Acknowledgementsmentioning

confidence: 99%

Point of care testing for detection of coronaviruses including SARS-CoV-2 from saliva without treating RNA in advance

Muraoka¹,

Kawaguchi²,

Mizukoshi³

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Coronavirus disease 2019 (COVID-19) outbreak was reported to the WHO (World Health Organization) as an outbreak on end of 2019, afterwards pandemic on the worldwide in 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has be reported it to cause COVID-19, and highly transmissible. Therefore, it is important that it is rapidly and continuously detected and monitored on site so that the infection is prevented. Namely, POCT (point of care testing) may be important to control cross infection of SARS-CoV-2. At present, the routine confirmation of SARS-CoV-2 is based on detection of sequence unique in the virus RNA by nucleic acid amplification tests (NAATs) such as rRT-PCR. Taking POCT into account, it is clear that it takes time and labour very much or much. Thus, it was our purpose this time to contribute to develop POCT for microbes such as SARS-CoV-2, and thus needed to improve NAATs method.First, combining the mobile real-time RT-PCR (rRT-PCR) device PCR1100 with the appropriate rRT-PCR reagent, we found that it is possible to detect RNA of SARS-CoV-2 for less 14 minutes with equivalent accuracy to conventional devices. Next, we found that the above method made it possible for us to detect coronaviruses by direct rRT-PCR without pre-treatments. Furthermore, it also made clear that coronaviruses in saliva could be detected by the similar direct rRT-PCR method.Hence, it was concluded that this method made it possible to detect virus in saliva without treating in advance (extraction, purification, concentration, etc.), and moreover, samples would be able to be collected with non-invasive. For this reason, we suggest that this method is useful for POCT of coronaviruses including SARS-CoV-2.

show abstract

Quickly And Simply Detection For Coronavirus Including SARS-CoV-2 On The Mobile Real-Time PCR Device And Without RNA Extraction

Cited by 5 publications

References 22 publications

Direct detection of microorganisms responsible for the sexually transmitted infection on the mobile real-time PCR device without treating in advance

Direct detection of microorganisms responsible for the sexually transmitted infection on the mobile real-time PCR device without treating in advance

Direct detection of Dengue viruses without extraction of RNA on the mobile real-time PCR device

Point of care testing for detection of coronaviruses including SARS-CoV-2 from saliva without treating RNA in advance

Contact Info

Product

Resources

About