Random antisense cDNA mutagenesis as an efficient functional genomic approach in higher plants

Jun, Ji Hyung; Kim, Cheol Soo; Cho, Dae Shik; Kwak, June M.; Ha, Chan Man; Park, Yu Shin; Cho, Baik Ho; Patton, David A.; Nam, Hong Gil

doi:10.1007/s004250100668

Cited by 11 publications

(7 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There have been similar attempts to analyze gene function using conventional non‐normalized cDNA libraries introduced randomly into plants (Banno et al. , 2001; Jun et al. , 2002; LeClere and Bartel, 2001).…”

Section: Resultsmentioning

confidence: 99%

The FOX hunting system: an alternative gain‐of‐function gene hunting technique

et al. 2006

View full text Add to dashboard Cite

SummaryWe have developed a novel gain-of-function system that we have named the FOX hunting system (Full-length cDNA Over-eXpressing gene hunting system). We used normalized full-length cDNA and introduced each cDNA into Arabidopsis by in planta transformation. About 10 000 independent full-length Arabidopsis cDNAs were expressed independently under the CaMV 35S promoter in Arabidopsis. Each transgenic Arabidopsis contained on average 2.6 cDNA clones and was monitored under various categories such as morphological changes, fertility and leaf color. We found 1487 possible morphological mutants from 15 547 transformants. When 115 pale green T 1 mutants were analyzed, 59 lines represented the mutant phenotypes in more than 50% of the T 2 progeny. Characterization of two leaf color mutants revealed the significance of this approach. We also document mutants from several categories and their corresponding full-length cDNAs.

show abstract

Section: Resultsmentioning

confidence: 99%

The FOX hunting system: an alternative gain‐of‐function gene hunting technique

et al. 2006

View full text Add to dashboard Cite

show abstract

“…, 2001), many of which play crucial roles in plant development and growth. In an effort to identify the MYB transcription factors involved in photosignaling and leaf senescence, the two major interests in this laboratory, we systemically generated antisense transgenic lines in which DNA encoding the C‐terminal portion of individual MYB transcription factor genes was expressed in the antisense direction using a vector previously developed for random antisense mutagenesis of Arabidopsis (Jun et al. , 2002).…”

Section: Resultsmentioning

confidence: 99%

“…To generated antisense lines of MYB38 / BIT1 , a 546‐bp BIT1 cDNA fragment (349–894 from the translation initiation site of the BIT1 cDNA clone) was amplified by PCR using the primers 5′‐GAATCCCTCATAGCCACCATGGCTCCTC‐3′ and 5′‐CTCGAGAGTAGTACAACATGAACTTATCCTCC‐3′. The amplified fragment was cloned into pNB96 (Jun et al. , 2002) using the Eco RI and Xho I restriction sites, resulting in insertion of the BIT1 sequence in the antisense orientation under the control of the dual 35S promoter.…”

Section: Methodsmentioning

confidence: 99%

CRY1 inhibits COP1‐mediated degradation of BIT1, a MYB transcription factor, to activate blue light‐dependent gene expression in Arabidopsis

et al. 2008

View full text Add to dashboard Cite

SummaryCryptochromes (CRY) are one of the two major classes of photoreceptors that perceive light stimuli in the UV-A to blue light region and they are involved in multiple aspects of plant growth and development. However, knowledge regarding their signaling transduction components and mechanisms remains limited. Here, we report that a MYB transcription factor Blue Insensitive Trait 1 (BIT1), plays an important role in controlling blue light responses. Hypocotyl growth responses indicate that BIT1 functions as a positive element in blue light signaling, since BIT1 antisense and knock-out lines show a reduced light response in blue light. BIT1 controls blue light-dependent expression of various genes such as PsbS, a member of the light-harvesting complex gene family. A transactivation assay showed that BIT1 regulates promoter activity of PsbS in a blue lightdependent manner and that it requires CRY1 for activation of the PsbS promoter. BIT1 undergoes degradation in darkness and CRY1 functions to stabilize BIT1 in a blue light-dependent manner. In contrast, COP1 binds to BIT1 and mediates its degradation. We propose that the PsbS promoter is activated in blue light via the blue light-dependent stabilization of BIT1 by CRY1, while in darkness BIT1 is degraded by COP1-mediated proteolysis.

show abstract

“…Gene silencing lines are also very important in elucidating gene function, especially for genes for which no suitable (reduced/loss of function) T‐DNA insertion alleles are available, or for genes belonging to families in which redundancy is an issue. The feasibility of generating large‐scale functional antisense lines has been demonstrated using random antisense cDNAs (Jun et al. , 2002).…”

Section: Introductionmentioning

confidence: 99%

Getting the most out of publicly available T‐DNA insertion lines

et al. 2008

View full text Add to dashboard Cite

SummaryIn the course of several different projects, we came to realize that there is a significant amount of untapped potential in the publicly available T-DNA insertion lines. In addition to the GABI-Kat lines, which were designed specifically for activation tagging, lines from the SAIL and FLAGdb collections are also useful for this purpose. As well as the 35S promoter chosen for activation tagging in GABI-Kat lines, we found that the 1¢2¢ bidirectional promoter is capable of activating expression of flanking genomic sequences in both GABI-Kat and SAIL lines. Thus these lines have added potential for activation tagging. We also show that these lines are capable of generating antisense transcripts and so have the potential to be used for suppression (loss/reduction of function) studies. By virtue of weak terminator sequences in some T-DNA constructs, transcript read-through from selectable markers is also possible, which again has the potential to be exploited in activation/ suppression studies. Finally, we show that, by selecting and characterizing lines in which the T-DNA insertions are present specifically within introns of a target gene, an allelic series of mutants with varying levels of reduced expression can be generated, due to differences in efficiency of intron splicing. Taken together, our analyses demonstrate that there is a wealth of untapped potential within existing insertion lines for studies on gene function, and the effective exploitation of these resources is discussed.

show abstract

Random antisense cDNA mutagenesis as an efficient functional genomic approach in higher plants

Cited by 11 publications

References 21 publications

The FOX hunting system: an alternative gain‐of‐function gene hunting technique

The FOX hunting system: an alternative gain‐of‐function gene hunting technique

CRY1 inhibits COP1‐mediated degradation of BIT1, a MYB transcription factor, to activate blue light‐dependent gene expression in Arabidopsis

Getting the most out of publicly available T‐DNA insertion lines

Contact Info

Product

Resources

About