Rapid assembly of SARS-CoV-2 genomes reveals attenuation of the Omicron BA.1 variant through NSP6

Abstract

Although the SARS-CoV-2 Omicron variant (BA.1) spread rapidly across the world and effectively evaded immune responses, its viral fitness in cell and animal models was reduced. The precise nature of this attenuation remains unknown as generating replication-competent viral genomes is challenging because of the length of the viral genome (30kb). Here, we designed a plasmid-based viral genome assembly and rescue strategy (pGLUE) that constructs complete infectious viruses or noninfectious subgenomic replicons in a single ligation reaction with >80% efficiency. Fully sequenced replicons and infectious viral stocks can be generated in 1 and 3 weeks, respectively. By testing a series of naturally occurring viruses as well as Delta-Omicron chimeric replicons, we show that Omicron nonstructural protein 6 harbors critical attenuating mutations, which dampen viral RNA replication and reduce lipid droplet consumption. Thus, pGLUE overcomes remaining barriers to broadly study SARS-CoV-2 replication and reveals deficits in nonstructural protein function underlying Omicron attenuation.

A single inactivating amino acid change in the SARS-CoV-2 NSP3 Mac1 domain attenuates viral replication and pathogenesisin vivo

“…They were used to infect simian Vero cells overexpressing the ACE2 and TMPRSS2 entry factors (VAT) or human Calu3 lung adenocarcinoma cells naturally expressing both factors. We measured secreted nanoluciferase in the supernatant, which reflects intracellular viral RNA levels (34). The N40D mutant generated similar luciferase signals to the WT replicon in both VAT and Calu3 cells, while the Mac1 N40A mutant showed an ~10-fold reduction (Fig.…”

“…Next, the N40A and N40D mutants were introduced into SARS-CoV-2 replicons to determine their impact on viral RNA replication in a rapid and safe manner (34). The replicons express secreted nanoluciferase as a reporter au lieu of the spike-coding sequence and can produce single-round infectious particles when supplied with a separate spike expression vector (Fig.…”

“…Plasmids were validated by whole plasmid sequencing (Primordium). SARS-CoV-2 replicon and infectious clone plasmids were constructed as described previously (34). Briefly, the N40A and N40D mutants were cloned by utilizing NEB HiFi DNA assembly kit onto the second fragment (W2) of the WA1 genetic background.…”

“…The SARS-CoV-2 replicon assay was conducted as described previously (34). Briefly, the pBAC SARS-CoV-2 Δ Spike WT, N40A, or N40D plasmid (1 µg), was transfected into BHK21 cells along with N and S expression vectors (0.5 µg each) in 24-well.…”

“…N gene primer sequences are: Forward 5′ AAATTTTGGGGACCAGGAAC 3′; Reverse 5′ TGGCACCTGTGTAGGTCAAC 3′. The tenth fragment of the infectious clone plasmid (34) was used as a standard for N gene quantification by RT-qPCR.…”