Rapid assessment of protein-tyrosine phosphatase expression levels by RT-PCR with degenerate primers

Abstract

Using degenerate oligodeoxynucleotide primers we previously obtained cDNA fragments from ten different murine protein-tyrosine phosphatases (PTPases). Employing this same primer set, a method was developed to assess the expression levels of these PTPase family members in a fast and simple way. RT-PCR products of several cell types and tissue samples were used as probes on dot-blots containing the ten different PTPase fragments in equimolar amounts. Hybridization intensities at the various dots reflect the relative expression levels of the corresponding PTPases in the starting material. In this way expression of PTPases during mouse brain development could be monitored. Expression of PTP delta was found to be absent in embryonic stem cells but high in fetal and adult brain. PTP epsilon expression is shown to gradually increase in brain during maturation. Our method is generally applicable to gene families of which the transcripts can be detected with a single degenerate primer pair and is especially useful in situations where only limited amounts of RNA can be obtained.

The neuronal nitric oxide synthase PDZ motif binds to ‐G(D,E)XV* carboxyterminal sequences

“…Total RNA was isolated using the LiCl/urea method [25]. SAP90 cDNA fragment was generated by reverse transcriptase (RT)‐PCR as described [26]. Specific oligonucleotide primers SAP90‐1 (5′‐CCAGATCTGCAGTGGAGGCCC‐3′) and SAP90‐2 (5′‐AGGCTCGAGGTCCTTGGCCAC‐3′) were deduced from the published sequence [27].…”

“…A cDNA fragment encoding the last 114 amino acid residues of the rat α1C‐adrenergic receptor [28]was generated by reverse transcriptase (RT)‐PCR [26]using oligonucleotide primers α1CAR‐1 (5′‐GGAATTCAAGCATGCCCTGGG‐3′) and α1CAR‐2 (5′‐ATACTCGAGCTAGACTTCCTCCCCGTT‐3′). The PCR product was digested with Eco RI and Xho I and subcloned in the prey vector pJG4‐5.…”

Molecular cloning of a mouse epithelial protein‐tyrosine phosphatase with similarities to submembranous proteins

“…The antisense primer (5'-CCTGATTGAT-CAAGTTGCC-3') was chosen close to the 5' end of clone mPTP14-2 (position 1,390-1,409 of the PTP-BL cDNA sequence). Mouse keratinocyte RNA (2 jxg) was isolated and used for cDNA synthesis in a reverse transcription reaction em ploying random hexamers as described previ ously [Hendriks et al, 1994]. Following a 5 min incubation at 90°C, 5 \il of the single-stranded cDNA preparation was used as template for PCR.…”

“…In addi tion, RT-PCR experiments had revealed the ex pression of PTP-BL mRNA in murine embry onic stem cells derived from the blastocyst inner cell mass [Hendriks et al, 1994]. Therefore, we performed RNA in situ hybridization experi ments on fetal and postnatal murine tissue sec tions to determine the expression patterns dur ing development and in adult tissues more precisely.…”