Rapid automated synthesis via diisopropyl phosphoramidite <i>in situ</i> activation. Chemical synthesis and cloning of a calmodulin gene

Alvarado-Urbina, Gabriel; Chiarello, Ronald H.; Roberts, Daniel P.; Vilain, G.; Jurik, F.; Christensen, Leif; Carmona, Catalina Gómez; Fang, Lizheng; Watterson, Mark P.; Crea, Roberto

doi:10.1139/o86-077

Cited by 6 publications

(4 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sequencing of double-stranded templates was done on an ABI model 373A automated DNA sequencer using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.) according to the manufacturer's protocol. Oligonucleotide primers were synthesized on an ABI model 380B DNA synthesizer using phosphoramidite chemistry (1). Sequencing of the gacA gene of Pf-5 was done with primers complementary to pUC19 DNA on either side of the polylinker and by oligonucleotide primers complementary to regions within the 1.65-kb fragment of pJEL5937 containing gacA.…”

Section: Methodsmentioning

confidence: 99%

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5

Whistler¹,

et al. 1998

View full text Add to dashboard Cite

Three global regulators are known to control antibiotic production by Pseudomonas fluorescens. A two-component regulatory system comprised of the sensor kinase GacS (previously called ApdA or LemA) and GacA, a member of the FixJ family of response regulators, is required for antibiotic production. A mutation inrpoS, which encodes the stationary-phase sigma factor ςS, differentially affects antibiotic production and reduces the capacity of stationary-phase cells of P. fluorescens to survive exposure to oxidative stress. ThegacA gene of P. fluorescens Pf-5 was isolated, and the influence of gacS and gacA onrpoS transcription, ςS levels, and oxidative stress response of Pf-5 was determined. We selected a gacAmutant of Pf-5 that contained a single nucleotide substitution within a predicted α-helical region, which is highly conserved among the FixJ family of response regulators. At the entrance to stationary phase, ςS content in gacS and gacAmutants of Pf-5 was less than 20% of the wild-type level. Transcription of rpoS, assessed with anrpoS-lacZ transcriptional fusion, was positively influenced by GacS and GacA, an effect that was most evident at the transition between exponential growth and stationary phase. Mutations ingacS and gacA compromised the capacity of stationary-phase cells of Pf-5 to survive exposure to oxidative stress. The results of this study provide evidence for the predominant roles of GacS and GacA in the regulatory cascade controlling stress response and antifungal metabolite production in P. fluorescens.

show abstract

Section: Methodsmentioning

confidence: 99%

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5

Whistler¹,

et al. 1998

View full text Add to dashboard Cite

show abstract

“…Primers included pUC universal primers, tetracycline resistance gene primers (5Ј TACTTGGAGCCACTATCGACTACGCGATCA 3Ј and 5Ј ATG CGTCCGGCGTAGA 3Ј), and primers designed from previous sequence determinations. Primers were synthesized at the Center for Gene Research and Biotechnology on an ABI 380B DNA synthesizer using phosphoramidite chemistry (2). Sequences were assembled with Staden software (19) and analyzed with the Genetics Computer Group package (20).…”

Section: Methodsmentioning

confidence: 99%

Cloning of Genomic DNA of Lactococcus lactis That Restores Phage Sensitivity to an Unusual Bacteriophage sk1-Resistant Mutant

Kraus

Geller

2001

Appl Environ Microbiol

View full text Add to dashboard Cite

An unusual, spontaneous, phage sk1-resistant mutant (RMSK1/1) of Lactococcus lactis C2 apparently blocks phage DNA entry into the host. Although no visible plaques formed on RMSK1/1, this host propagated phage at a reduced efficiency. This was evident from center-of-infection experiments, which showed that 21% of infected RMSK1/1 formed plaques when plated on its phage-sensitive parental strain, C2. Moreover, viable cell counts 0 and 4 h after infection were not significantly different from those of an uninfected culture. Further characterization showed that phage adsorption was normal, but burst size was reduced fivefold and the latent period was increased from 28.5 to 36 min. RMSK1/1 was resistant to other, but not all, similar phages. Phage sensitivity was restored to RMSK1/1 by transformation with a cloned DNA fragment from a genomic library of a phage-sensitive strain. Characterization of the DNA that restored phage sensitivity revealed an open reading frame with similarity to sequences encoding lysozymes (␤-1,4-N-acetylmuramidase) and lysins from various bacteria, a fungus, and phages of Lactobacillus and Streptococcus and also revealed DNA homologous to noncoding sequences of temperate phage of L. lactis, DNA similar to a region of phage sk1, a gene with similarity to tRNA genes, a prophage attachment site, and open reading frames with similarities to sun and to sequences encoding phosphoprotein phosphatases and protein kinases. Mutational analyses of the cloned DNA showed that the region of homology with lactococcal temperate phage was responsible for restoring the phage-sensitive phenotype. The region of homology with DNA of lactococcal temperate phage was similar to DNA from a previously characterized lactococcal phage that suppresses an abortive infection mechanism of phage resistance. The region of homology with lactococcal temperate phage was deleted from a phage-sensitive strain, but the strain was not phage resistant. The results suggest that the cloned DNA with homology to lactococcal temperate phage was not mutated in the phage-resistant strain. The cloned DNA apparently suppressed the mechanism of resistance, and it may do so by mimicking a region of phage DNA that interacts with components of the resistance mechanism.Bacteriophage infection of lactic acid-producing starter cultures is the most persistent problem in manufacturing fermented milk products. Although naturally occurring bacteriophage resistance mechanisms have been applied successfully in the development of new bacteriophage-resistant starter cultures, novel bacteriophages have arisen that overcome these resistances (49). Starter strains bearing latent prophage may serve as a source of genes in the continuous evolution of bacteriophages (7,24,60) and their hosts.To expand the range of possibilities for development of phage-resistant starter strains, we continue to identify host genes that affect phage replication. These genes are a potential source of novel phage resistance. A prototypical example is pip, a gene carried by many str...

show abstract

“…The sequencing of double-stranded templates was performed on an ABI 373A automated DNA sequencer with a Taq DyeDeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster City, Calif.) according to the manufacturer's protocol. Oligonucleotide primers were synthesized on an ABI 380B DNA synthesizer by phosphoramidite chemistry (2). Initial sequencing of the apdA locus was performed on regions flanking the Tn5 inserts of three ApdA Ϫ mutants (JL4106, JL4135, and JL4210).…”

Section: Methodsmentioning

confidence: 99%

A global regulator of secondary metabolite production in Pseudomonas fluorescens Pf-5

1995

View full text Add to dashboard Cite

Mutations in the apdA (for antibiotic production) gene of the plant root-colonizing bacterium Pseudomonas fluorescens Pf-5 pleiotropically abolish the production of an array of antibiotics, including pyrrolnitrin, pyoluteorin, and 2,4-diacetylphloroglucinol, as well as the production of tryptophan side chain oxidase, hydrogen cyanide, and an extracellular protease. The lack of production of secondary metabolites by ApdA

show abstract

Rapid automated synthesis via diisopropyl phosphoramidite in situ activation. Chemical synthesis and cloning of a calmodulin gene

Cited by 6 publications

References 0 publications

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5

Cloning of Genomic DNA of Lactococcus lactis That Restores Phage Sensitivity to an Unusual Bacteriophage sk1-Resistant Mutant

A global regulator of secondary metabolite production in Pseudomonas fluorescens Pf-5

Contact Info

Product

Resources

About

Rapid automated synthesis via diisopropyl phosphoramidite in situ activation. Chemical synthesis and cloning of a calmodulin gene

Cited by 6 publications

References 0 publications

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς S and the Stress Response in Pseudomonas fluorescens Pf-5

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς S and the Stress Response in Pseudomonas fluorescens Pf-5

Cloning of Genomic DNA of Lactococcus lactis That Restores Phage Sensitivity to an Unusual Bacteriophage sk1-Resistant Mutant

A global regulator of secondary metabolite production in Pseudomonas fluorescens Pf-5

Contact Info

Product

Resources

About

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5

The Two-Component Regulators GacS and GacA Influence Accumulation of the Stationary-Phase Sigma Factor ς ^S and the Stress Response in Pseudomonas fluorescens Pf-5